Incidental Mutation 'R3946:Synj1'
ID 307730
Institutional Source Beutler Lab
Gene Symbol Synj1
Ensembl Gene ENSMUSG00000022973
Gene Name synaptojanin 1
Synonyms A930006D20Rik
MMRRC Submission 040827-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3946 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 90732980-90808196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90806984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 58 (F58L)
Ref Sequence ENSEMBL: ENSMUSP00000113308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118522] [ENSMUST00000121759] [ENSMUST00000130813] [ENSMUST00000170853]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023698
SMART Domains Protein: ENSMUSP00000023698
Gene: ENSMUSG00000022974

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 60 86 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 434 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118246
Predicted Effect unknown
Transcript: ENSMUST00000118390
AA Change: F32L
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973
AA Change: F32L

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118522
SMART Domains Protein: ENSMUSP00000113835
Gene: ENSMUSG00000022974

DomainStartEndE-ValueType
coiled coil region 3 28 N/A INTRINSIC
low complexity region 114 120 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
Pfam:GCFC 597 812 5.1e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121759
AA Change: F58L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973
AA Change: F58L

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125902
Predicted Effect probably benign
Transcript: ENSMUST00000130813
AA Change: F18L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119712
Gene: ENSMUSG00000022973
AA Change: F18L

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.4e-86 PFAM
low complexity region 441 459 N/A INTRINSIC
IPPc 526 693 1.8e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156140
Predicted Effect probably benign
Transcript: ENSMUST00000170853
AA Change: F18L

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973
AA Change: F18L

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Meta Mutation Damage Score 0.0984 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit neurological defects associated with impaired phosphoinositide metabolism and accumulation of clathrin-coated vesicles at nerve endings. Mutants show impaired suckling and most die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 A G 1: 60,492,913 (GRCm39) Q328R probably damaging Het
Agr3 C A 12: 35,997,512 (GRCm39) probably benign Het
Brca2 T A 5: 150,460,169 (GRCm39) S481R probably damaging Het
Cabin1 T G 10: 75,581,093 (GRCm39) Q411P probably damaging Het
Calr3 A G 8: 73,197,464 (GRCm39) Y22H probably damaging Het
Caprin1 T A 2: 103,627,111 (GRCm39) I59F probably damaging Het
Cdk5rap1 T C 2: 154,190,636 (GRCm39) T442A probably damaging Het
Chn2 T C 6: 54,246,411 (GRCm39) probably benign Het
Cic C A 7: 24,971,771 (GRCm39) R501S possibly damaging Het
Coch A G 12: 51,648,595 (GRCm39) probably null Het
Defa25 G A 8: 21,574,506 (GRCm39) V17I probably null Het
Dglucy T C 12: 100,804,959 (GRCm39) probably null Het
Dtx1 T G 5: 120,819,351 (GRCm39) T616P possibly damaging Het
Eef1g T C 19: 8,947,341 (GRCm39) L171P probably benign Het
Fam135a A G 1: 24,069,475 (GRCm39) S465P probably damaging Het
Gm14412 A T 2: 177,006,478 (GRCm39) C472* probably null Het
Gm7104 T C 12: 88,252,812 (GRCm39) noncoding transcript Het
Got2 A G 8: 96,614,858 (GRCm39) S26P probably benign Het
H2-M11 A G 17: 36,860,123 (GRCm39) I329M probably damaging Het
Hmcn2 T A 2: 31,272,406 (GRCm39) D1295E possibly damaging Het
Hoxd12 G T 2: 74,505,771 (GRCm39) R114L probably damaging Het
Ilkap A C 1: 91,314,972 (GRCm39) D124E probably damaging Het
Maco1 A G 4: 134,531,792 (GRCm39) Y626H probably damaging Het
Med6 T C 12: 81,628,625 (GRCm39) Y88C probably damaging Het
Mep1a A T 17: 43,785,932 (GRCm39) L719* probably null Het
Mmp23 T C 4: 155,736,480 (GRCm39) Y187C probably damaging Het
Myo1g A G 11: 6,470,760 (GRCm39) M32T possibly damaging Het
Ncstn T C 1: 171,895,061 (GRCm39) E614G probably benign Het
Nr2c2 C T 6: 92,140,119 (GRCm39) R464W probably damaging Het
Or4f15 G A 2: 111,813,642 (GRCm39) T259M possibly damaging Het
Otub2 T A 12: 103,359,085 (GRCm39) L58* probably null Het
Pcdhga12 G A 18: 37,900,682 (GRCm39) V505I probably benign Het
Pcdhga9 T A 18: 37,870,897 (GRCm39) V242D probably damaging Het
Pex1 C T 5: 3,676,084 (GRCm39) L891F probably damaging Het
Pgm2 C T 5: 64,269,404 (GRCm39) T497I probably benign Het
Pikfyve T C 1: 65,235,840 (GRCm39) F171L probably damaging Het
Pilrb1 T G 5: 137,855,654 (GRCm39) K79T probably benign Het
Pin1 C T 9: 20,566,660 (GRCm39) R21W probably damaging Het
Prxl2c T C 13: 64,456,912 (GRCm39) I104V probably damaging Het
Ptprq A G 10: 107,522,253 (GRCm39) probably benign Het
Rad17 G A 13: 100,759,371 (GRCm39) A552V possibly damaging Het
Rbbp8 A G 18: 11,851,925 (GRCm39) T249A probably benign Het
Rtkn A T 6: 83,112,957 (GRCm39) I10F probably benign Het
Scube2 T A 7: 109,456,797 (GRCm39) I103F possibly damaging Het
Sec23b A G 2: 144,423,893 (GRCm39) H514R probably benign Het
Serbp1 T A 6: 67,249,204 (GRCm39) D223E probably benign Het
Slc14a1 C A 18: 78,154,607 (GRCm39) V260L probably benign Het
Slc22a23 A G 13: 34,367,109 (GRCm39) I633T probably damaging Het
Stk19 A T 17: 35,043,723 (GRCm39) probably benign Het
Svs5 T C 2: 164,079,047 (GRCm39) M287V probably benign Het
Syne3 T A 12: 104,924,325 (GRCm39) Q358L probably damaging Het
Tg T C 15: 66,545,872 (GRCm39) V198A probably damaging Het
Tle4 A T 19: 14,574,752 (GRCm39) Y9N probably damaging Het
Tmx3 G A 18: 90,542,459 (GRCm39) A186T possibly damaging Het
Traf3 G A 12: 111,221,679 (GRCm39) S280N possibly damaging Het
Trmt13 A G 3: 116,375,167 (GRCm39) F447S probably damaging Het
Trp53bp1 T A 2: 121,059,107 (GRCm39) H918L probably damaging Het
Ush2a T G 1: 188,460,701 (GRCm39) V2654G probably benign Het
Vinac1 A G 2: 128,881,521 (GRCm39) L135P probably damaging Het
Vmn2r25 A G 6: 123,817,057 (GRCm39) Y175H probably damaging Het
Zfp335 T C 2: 164,734,109 (GRCm39) D1330G probably damaging Het
Other mutations in Synj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Synj1 APN 16 90,748,864 (GRCm39) missense probably damaging 1.00
IGL01468:Synj1 APN 16 90,807,060 (GRCm39) splice site probably benign
IGL02209:Synj1 APN 16 90,784,307 (GRCm39) missense probably damaging 0.97
IGL02452:Synj1 APN 16 90,758,253 (GRCm39) splice site probably benign
IGL02619:Synj1 APN 16 90,770,933 (GRCm39) missense probably damaging 1.00
IGL02650:Synj1 APN 16 90,773,584 (GRCm39) missense probably benign 0.03
IGL02708:Synj1 APN 16 90,788,350 (GRCm39) missense probably damaging 1.00
IGL02863:Synj1 APN 16 90,758,322 (GRCm39) missense possibly damaging 0.94
IGL03131:Synj1 APN 16 90,785,056 (GRCm39) missense probably damaging 0.99
IGL03295:Synj1 APN 16 90,735,318 (GRCm39) missense probably benign 0.14
IGL03356:Synj1 APN 16 90,784,280 (GRCm39) missense probably damaging 1.00
PIT1430001:Synj1 UTSW 16 90,761,396 (GRCm39) missense probably damaging 1.00
R0179:Synj1 UTSW 16 90,761,519 (GRCm39) missense possibly damaging 0.80
R0396:Synj1 UTSW 16 90,735,528 (GRCm39) missense probably benign
R0426:Synj1 UTSW 16 90,764,242 (GRCm39) missense probably damaging 1.00
R0486:Synj1 UTSW 16 90,735,151 (GRCm39) utr 3 prime probably benign
R0515:Synj1 UTSW 16 90,790,910 (GRCm39) missense possibly damaging 0.93
R0535:Synj1 UTSW 16 90,744,975 (GRCm39) missense possibly damaging 0.80
R0697:Synj1 UTSW 16 90,757,503 (GRCm39) missense probably benign 0.44
R0698:Synj1 UTSW 16 90,757,503 (GRCm39) missense probably benign 0.44
R0945:Synj1 UTSW 16 90,757,333 (GRCm39) missense possibly damaging 0.90
R1327:Synj1 UTSW 16 90,743,743 (GRCm39) missense probably benign 0.05
R1562:Synj1 UTSW 16 90,784,290 (GRCm39) missense probably benign 0.09
R1732:Synj1 UTSW 16 90,761,118 (GRCm39) missense probably damaging 0.99
R1752:Synj1 UTSW 16 90,735,361 (GRCm39) missense probably benign
R1785:Synj1 UTSW 16 90,761,405 (GRCm39) missense probably damaging 1.00
R1786:Synj1 UTSW 16 90,761,405 (GRCm39) missense probably damaging 1.00
R2011:Synj1 UTSW 16 90,735,584 (GRCm39) missense probably damaging 1.00
R2012:Synj1 UTSW 16 90,735,584 (GRCm39) missense probably damaging 1.00
R2065:Synj1 UTSW 16 90,788,537 (GRCm39) critical splice acceptor site probably null
R2862:Synj1 UTSW 16 90,766,217 (GRCm39) missense probably damaging 1.00
R3026:Synj1 UTSW 16 90,775,622 (GRCm39) missense probably damaging 1.00
R3151:Synj1 UTSW 16 90,757,514 (GRCm39) missense probably damaging 0.96
R3971:Synj1 UTSW 16 90,788,491 (GRCm39) missense probably damaging 1.00
R4472:Synj1 UTSW 16 90,766,069 (GRCm39) critical splice donor site probably null
R4547:Synj1 UTSW 16 90,785,170 (GRCm39) missense possibly damaging 0.51
R4647:Synj1 UTSW 16 90,770,877 (GRCm39) missense probably damaging 1.00
R4739:Synj1 UTSW 16 90,752,307 (GRCm39) missense probably benign 0.00
R5027:Synj1 UTSW 16 90,737,407 (GRCm39) splice site probably null
R5428:Synj1 UTSW 16 90,788,406 (GRCm39) missense probably damaging 0.98
R5586:Synj1 UTSW 16 90,806,865 (GRCm39) intron probably benign
R5769:Synj1 UTSW 16 90,735,141 (GRCm39) utr 3 prime probably benign
R6005:Synj1 UTSW 16 90,766,174 (GRCm39) missense probably damaging 1.00
R6119:Synj1 UTSW 16 90,735,877 (GRCm39) missense probably benign 0.30
R6313:Synj1 UTSW 16 90,743,703 (GRCm39) missense probably benign 0.00
R6324:Synj1 UTSW 16 90,735,518 (GRCm39) missense probably benign 0.00
R6549:Synj1 UTSW 16 90,735,565 (GRCm39) missense probably benign
R6696:Synj1 UTSW 16 90,757,340 (GRCm39) missense probably damaging 0.98
R6698:Synj1 UTSW 16 90,757,340 (GRCm39) missense probably damaging 0.98
R6861:Synj1 UTSW 16 90,760,768 (GRCm39) nonsense probably null
R7008:Synj1 UTSW 16 90,790,833 (GRCm39) missense probably damaging 1.00
R7153:Synj1 UTSW 16 90,744,978 (GRCm39) missense probably benign 0.04
R7393:Synj1 UTSW 16 90,748,887 (GRCm39) missense probably damaging 0.99
R7510:Synj1 UTSW 16 90,735,565 (GRCm39) missense probably benign
R7560:Synj1 UTSW 16 90,737,371 (GRCm39) missense probably benign
R7724:Synj1 UTSW 16 90,758,387 (GRCm39) missense probably damaging 0.99
R7913:Synj1 UTSW 16 90,788,315 (GRCm39) missense possibly damaging 0.83
R8326:Synj1 UTSW 16 90,785,084 (GRCm39) missense probably benign 0.12
R8707:Synj1 UTSW 16 90,752,319 (GRCm39) missense probably benign 0.02
R8711:Synj1 UTSW 16 90,806,971 (GRCm39) missense probably damaging 0.98
R8767:Synj1 UTSW 16 90,758,406 (GRCm39) missense probably damaging 1.00
R8911:Synj1 UTSW 16 90,775,622 (GRCm39) missense probably damaging 1.00
R9052:Synj1 UTSW 16 90,735,728 (GRCm39) missense probably benign 0.00
R9124:Synj1 UTSW 16 90,735,513 (GRCm39) missense probably benign 0.00
R9307:Synj1 UTSW 16 90,785,095 (GRCm39) missense probably damaging 0.98
R9408:Synj1 UTSW 16 90,741,740 (GRCm39) missense probably benign 0.27
R9458:Synj1 UTSW 16 90,766,200 (GRCm39) missense probably benign 0.05
R9567:Synj1 UTSW 16 90,790,912 (GRCm39) missense possibly damaging 0.79
R9651:Synj1 UTSW 16 90,757,343 (GRCm39) missense possibly damaging 0.56
R9651:Synj1 UTSW 16 90,735,412 (GRCm39) missense probably benign 0.00
R9707:Synj1 UTSW 16 90,758,300 (GRCm39) missense possibly damaging 0.91
R9730:Synj1 UTSW 16 90,757,552 (GRCm39) missense probably damaging 0.98
R9732:Synj1 UTSW 16 90,761,414 (GRCm39) missense probably damaging 1.00
Z1176:Synj1 UTSW 16 90,784,228 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGAAGATCAAATTCAGGG -3'
(R):5'- TAAACCGTTCACCCCTGAGC -3'

Sequencing Primer
(F):5'- GATCAAATTCAGGGAGAAGGTTC -3'
(R):5'- GTTCACCCCTGAGCTCTCTTTTTC -3'
Posted On 2015-04-17