Incidental Mutation 'R3946:H2-M11'
ID307732
Institutional Source Beutler Lab
Gene Symbol H2-M11
Ensembl Gene ENSMUSG00000037537
Gene Namehistocompatibility 2, M region locus 11
Synonyms
MMRRC Submission 040827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36547075-36549250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36549231 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 329 (I329M)
Ref Sequence ENSEMBL: ENSMUSP00000042522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041964]
Predicted Effect probably damaging
Transcript: ENSMUST00000041964
AA Change: I329M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042522
Gene: ENSMUSG00000037537
AA Change: I329M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 2.8e-44 PFAM
IGc1 222 293 1.91e-18 SMART
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173968
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in H2-M11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:H2-M11 APN 17 36547553 missense probably benign 0.00
IGL01657:H2-M11 APN 17 36547573 missense probably benign 0.00
IGL02249:H2-M11 APN 17 36547937 missense probably benign 0.39
IGL03263:H2-M11 APN 17 36548913 missense probably damaging 1.00
R0481:H2-M11 UTSW 17 36548954 nonsense probably null
R0639:H2-M11 UTSW 17 36547391 missense probably benign 0.00
R0866:H2-M11 UTSW 17 36548937 missense probably benign 0.00
R0924:H2-M11 UTSW 17 36549214 missense probably benign
R0925:H2-M11 UTSW 17 36547461 missense probably benign 0.00
R1707:H2-M11 UTSW 17 36548766 missense probably damaging 1.00
R2212:H2-M11 UTSW 17 36548930 missense probably damaging 1.00
R2566:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R2567:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3029:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3030:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3893:H2-M11 UTSW 17 36547090 missense probably benign 0.01
R4647:H2-M11 UTSW 17 36547991 missense probably benign 0.06
R4679:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R4868:H2-M11 UTSW 17 36548919 missense probably damaging 1.00
R4876:H2-M11 UTSW 17 36547509 missense probably benign 0.09
R5496:H2-M11 UTSW 17 36547979 missense possibly damaging 0.73
R6514:H2-M11 UTSW 17 36548947 missense probably damaging 1.00
R7779:H2-M11 UTSW 17 36548806 missense probably benign 0.14
R8072:H2-M11 UTSW 17 36548134 missense probably benign 0.13
R8210:H2-M11 UTSW 17 36547968 missense probably damaging 0.98
R8249:H2-M11 UTSW 17 36549008 missense probably damaging 1.00
Z1176:H2-M11 UTSW 17 36548770 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACATAGACATGGTTCTGAGAGAGTG -3'
(R):5'- CTTTGACACCTGAGCACTGAG -3'

Sequencing Primer
(F):5'- CTGAGAGAGTGGGAGTGCTC -3'
(R):5'- CCTGAGCACTGAGAATAAGATCTCTG -3'
Posted On2015-04-17