Mutagenetix > Incidental Mutations

Incidental Mutation 'R3946:Rbbp8'

307734

Institutional Source

Beutler Lab

Gene Symbol

Rbbp8

Ensembl Gene

ENSMUSG00000041238

Gene Name

retinoblastoma binding protein 8, endonuclease

Synonyms

9930104E21Rik, CtIP

MMRRC Submission

040827-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3946 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11633276-11743207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11718868 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 249 (T249A)

Ref Sequence

ENSEMBL: ENSMUSP00000111527 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]

Predicted Effect

probably benign
Transcript: ENSMUST00000047322
AA Change: T249A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: T249A

Domain	Start	End	E-Value	Type
Pfam:CtIP_N	20	139	9.6e-61	PFAM
PDB:2L4Z\|A	639	675	3e-15	PDB
Pfam:SAE2	790	854	8.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115861
AA Change: T249A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: T249A

Domain	Start	End	E-Value	Type
Pfam:CtIP_N	20	139	5.2e-55	PFAM
PDB:2L4Z\|A	639	675	3e-15	PDB
Pfam:SAE2	817	854	1.4e-8	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,309,098	I104V	probably damaging	Het
Abi2	A	G	1: 60,453,754	Q328R	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Brca2	T	A	5: 150,536,704	S481R	probably damaging	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Calr3	A	G	8: 72,443,620	Y22H	probably damaging	Het
Caprin1	T	A	2: 103,796,766	I59F	probably damaging	Het
Cdk5rap1	T	C	2: 154,348,716	T442A	probably damaging	Het
Chn2	T	C	6: 54,269,426		probably benign	Het
Cic	C	A	7: 25,272,346	R501S	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Dglucy	T	C	12: 100,838,700		probably null	Het
Dtx1	T	G	5: 120,681,286	T616P	possibly damaging	Het
Eef1g	T	C	19: 8,969,977	L171P	probably benign	Het
Fam135a	A	G	1: 24,030,394	S465P	probably damaging	Het
Gm14025	A	G	2: 129,039,601	L135P	probably damaging	Het
Gm14412	A	T	2: 177,314,685	C472*	probably null	Het
Gm7104	T	C	12: 88,286,042		noncoding transcript	Het
Got2	A	G	8: 95,888,230	S26P	probably benign	Het
H2-M11	A	G	17: 36,549,231	I329M	probably damaging	Het
Hmcn2	T	A	2: 31,382,394	D1295E	possibly damaging	Het
Hoxd12	G	T	2: 74,675,427	R114L	probably damaging	Het
Ilkap	A	C	1: 91,387,250	D124E	probably damaging	Het
Med6	T	C	12: 81,581,851	Y88C	probably damaging	Het
Mep1a	A	T	17: 43,475,041	L719*	probably null	Het
Mmp23	T	C	4: 155,652,023	Y187C	probably damaging	Het
Myo1g	A	G	11: 6,520,760	M32T	possibly damaging	Het
Ncstn	T	C	1: 172,067,494	E614G	probably benign	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr1309	G	A	2: 111,983,297	T259M	possibly damaging	Het
Otub2	T	A	12: 103,392,826	L58*	probably null	Het
Pcdhga12	G	A	18: 37,767,629	V505I	probably benign	Het
Pcdhga9	T	A	18: 37,737,844	V242D	probably damaging	Het
Pex1	C	T	5: 3,626,084	L891F	probably damaging	Het
Pgm1	C	T	5: 64,112,061	T497I	probably benign	Het
Pikfyve	T	C	1: 65,196,681	F171L	probably damaging	Het
Pilrb1	T	G	5: 137,857,392	K79T	probably benign	Het
Pin1	C	T	9: 20,655,364	R21W	probably damaging	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rad17	G	A	13: 100,622,863	A552V	possibly damaging	Het
Rtkn	A	T	6: 83,135,976	I10F	probably benign	Het
Scube2	T	A	7: 109,857,590	I103F	possibly damaging	Het
Sec23b	A	G	2: 144,581,973	H514R	probably benign	Het
Serbp1	T	A	6: 67,272,220	D223E	probably benign	Het
Slc14a1	C	A	18: 78,111,392	V260L	probably benign	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Stk19	A	T	17: 34,824,747		probably benign	Het
Svs2	T	C	2: 164,237,127	M287V	probably benign	Het
Syne3	T	A	12: 104,958,066	Q358L	probably damaging	Het
Synj1	A	G	16: 91,010,096	F58L	possibly damaging	Het
Tg	T	C	15: 66,674,023	V198A	probably damaging	Het
Tle4	A	T	19: 14,597,388	Y9N	probably damaging	Het
Tmem57	A	G	4: 134,804,481	Y626H	probably damaging	Het
Tmx3	G	A	18: 90,524,335	A186T	possibly damaging	Het
Traf3	G	A	12: 111,255,245	S280N	possibly damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trp53bp1	T	A	2: 121,228,626	H918L	probably damaging	Het
Ush2a	T	G	1: 188,728,504	V2654G	probably benign	Het
Vmn2r25	A	G	6: 123,840,098	Y175H	probably damaging	Het
Zfp335	T	C	2: 164,892,189	D1330G	probably damaging	Het

Other mutations in Rbbp8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Rbbp8	APN	18	11722607	missense	probably benign
IGL01302:Rbbp8	APN	18	11721979	missense	probably benign
IGL01965:Rbbp8	APN	18	11722260	missense	probably benign	0.04
IGL02076:Rbbp8	APN	18	11705819	missense	probably damaging	1.00
IGL02410:Rbbp8	APN	18	11732212	missense	probably damaging	1.00
IGL02823:Rbbp8	APN	18	11732213	missense	possibly damaging	0.89
IGL02859:Rbbp8	APN	18	11738614	missense	probably benign	0.42
IGL02966:Rbbp8	APN	18	11705812	missense	possibly damaging	0.88
IGL03022:Rbbp8	APN	18	11725502	splice site	probably benign
IGL03274:Rbbp8	APN	18	11741076	splice site	probably benign
IGL03367:Rbbp8	APN	18	11721719	missense	probably benign	0.08
R0063:Rbbp8	UTSW	18	11734557	splice site	probably benign
R0063:Rbbp8	UTSW	18	11734557	splice site	probably benign
R0167:Rbbp8	UTSW	18	11660922	nonsense	probably null
R0314:Rbbp8	UTSW	18	11715818	missense	probably benign	0.17
R0864:Rbbp8	UTSW	18	11732184	splice site	probably benign
R1033:Rbbp8	UTSW	18	11742705	missense	probably benign	0.41
R1678:Rbbp8	UTSW	18	11732315	missense	probably benign	0.05
R1964:Rbbp8	UTSW	18	11742679	missense	possibly damaging	0.62
R2002:Rbbp8	UTSW	18	11727166	splice site	probably benign
R2015:Rbbp8	UTSW	18	11720624	missense	probably benign	0.01
R2240:Rbbp8	UTSW	18	11677669	missense	probably damaging	0.99
R2308:Rbbp8	UTSW	18	11696776	missense	possibly damaging	0.95
R4375:Rbbp8	UTSW	18	11725410	missense	probably benign	0.00
R4590:Rbbp8	UTSW	18	11732265	nonsense	probably null
R4695:Rbbp8	UTSW	18	11721782	nonsense	probably null
R4769:Rbbp8	UTSW	18	11722670	missense	probably damaging	1.00
R5161:Rbbp8	UTSW	18	11722114	missense	probably damaging	1.00
R5195:Rbbp8	UTSW	18	11722151	missense	probably benign	0.00
R5223:Rbbp8	UTSW	18	11721690	missense	probably benign	0.19
R5573:Rbbp8	UTSW	18	11722607	missense	probably benign
R5671:Rbbp8	UTSW	18	11742642	missense	probably benign	0.00
R6051:Rbbp8	UTSW	18	11738607	missense	probably benign	0.17
R6995:Rbbp8	UTSW	18	11718908	missense	probably damaging	1.00
R7048:Rbbp8	UTSW	18	11732220	missense	possibly damaging	0.92
R7261:Rbbp8	UTSW	18	11705742	missense	probably damaging	0.99
R7305:Rbbp8	UTSW	18	11672581	critical splice acceptor site	probably null
R7319:Rbbp8	UTSW	18	11732212	missense	probably damaging	1.00
R7447:Rbbp8	UTSW	18	11660877	missense	probably benign	0.00
R8010:Rbbp8	UTSW	18	11722233	missense	possibly damaging	0.67
R8116:Rbbp8	UTSW	18	11722670	missense	probably damaging	1.00
R8292:Rbbp8	UTSW	18	11705712	missense	probably benign
R8314:Rbbp8	UTSW	18	11720625	missense	probably benign	0.06
Z1176:Rbbp8	UTSW	18	11732262	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCGCCTAGGATCTTTGAGAAG -3'
(R):5'- GCCTGTGCCATCATAACTGG -3'

Sequencing Primer
(F):5'- CACTGTCATCTTTAAAATGGGA -3'
(R):5'- GTGCCATCATAACTGGCTCCTG -3'

Posted On

2015-04-17