Incidental Mutation 'R3946:Slc14a1'
ID307735
Institutional Source Beutler Lab
Gene Symbol Slc14a1
Ensembl Gene ENSMUSG00000059336
Gene Namesolute carrier family 14 (urea transporter), member 1
SynonymsUT-B, 2610507K20Rik, 3021401A05Rik
MMRRC Submission 040827-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location78100091-78142119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78111392 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 260 (V260L)
Ref Sequence ENSEMBL: ENSMUSP00000125114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091813] [ENSMUST00000160292] [ENSMUST00000160639]
Predicted Effect probably benign
Transcript: ENSMUST00000091813
AA Change: V204L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089421
Gene: ENSMUSG00000059336
AA Change: V204L

DomainStartEndE-ValueType
Pfam:UT 52 356 1.6e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160292
AA Change: V260L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125114
Gene: ENSMUSG00000059336
AA Change: V260L

DomainStartEndE-ValueType
Pfam:UT 110 405 6.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160639
AA Change: V204L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125367
Gene: ENSMUSG00000059336
AA Change: V204L

DomainStartEndE-ValueType
Pfam:UT 52 356 1.6e-120 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane transporter that mediates urea transport in erythrocytes. This gene forms the basis for the Kidd blood group system. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a grossly normal phenotype although they have an inability to concentrate urea in urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Slc14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Slc14a1 APN 18 78104073 missense probably damaging 1.00
Glen_eyrie UTSW 18 78110058 critical splice acceptor site probably null
R1726:Slc14a1 UTSW 18 78116466 missense probably benign 0.21
R1889:Slc14a1 UTSW 18 78109697 missense possibly damaging 0.95
R1895:Slc14a1 UTSW 18 78109697 missense possibly damaging 0.95
R4066:Slc14a1 UTSW 18 78111377 missense probably damaging 0.99
R5511:Slc14a1 UTSW 18 78102471 missense probably benign 0.01
R5763:Slc14a1 UTSW 18 78116414 missense probably benign 0.33
R6228:Slc14a1 UTSW 18 78116399 missense probably damaging 1.00
R6294:Slc14a1 UTSW 18 78110058 critical splice acceptor site probably null
R7157:Slc14a1 UTSW 18 78102411 missense probably benign 0.00
R7486:Slc14a1 UTSW 18 78111524 missense probably benign 0.00
R7657:Slc14a1 UTSW 18 78113664 critical splice donor site probably null
R8010:Slc14a1 UTSW 18 78116489 missense probably benign 0.09
R8028:Slc14a1 UTSW 18 78116512 missense probably benign 0.00
R8322:Slc14a1 UTSW 18 78102441 missense possibly damaging 0.73
Z1177:Slc14a1 UTSW 18 78104060 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGACTGAGCCAGAACAG -3'
(R):5'- TCACGGATTCTCATTCTGGG -3'

Sequencing Primer
(F):5'- AGTACAACATCCTGTTCTGACTGGG -3'
(R):5'- ACGGATTCTCATTCTGGGATTTC -3'
Posted On2015-04-17