Incidental Mutation 'R3947:Fnbp1l'
ID307743
Institutional Source Beutler Lab
Gene Symbol Fnbp1l
Ensembl Gene ENSMUSG00000039735
Gene Nameformin binding protein 1-like
SynonymsTOCA1, 2610318I01Rik
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122538719-122619715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122544579 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 481 (A481D)
Ref Sequence ENSEMBL: ENSMUSP00000124439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162409] [ENSMUST00000162947]
Predicted Effect possibly damaging
Transcript: ENSMUST00000162409
AA Change: A481D

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124439
Gene: ENSMUSG00000039735
AA Change: A481D

DomainStartEndE-ValueType
FCH 1 93 4.83e-18 SMART
coiled coil region 131 177 N/A INTRINSIC
PDB:2KE4|A 331 426 3e-30 PDB
low complexity region 468 477 N/A INTRINSIC
SH3 483 540 5.27e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162947
AA Change: A539D

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124947
Gene: ENSMUSG00000039735
AA Change: A539D

DomainStartEndE-ValueType
FCH 1 93 4.83e-18 SMART
coiled coil region 131 177 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
PDB:2KE4|A 389 484 4e-30 PDB
low complexity region 526 535 N/A INTRINSIC
SH3 541 598 5.27e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196051
Predicted Effect unknown
Transcript: ENSMUST00000197259
AA Change: A384D
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197342
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Fnbp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Fnbp1l APN 3 122549249 missense possibly damaging 0.81
IGL01655:Fnbp1l APN 3 122568749 splice site probably null
IGL01750:Fnbp1l APN 3 122544677 nonsense probably null
IGL02040:Fnbp1l APN 3 122570953 splice site probably benign
IGL02187:Fnbp1l APN 3 122568800 nonsense probably null
IGL03334:Fnbp1l APN 3 122557949 missense probably benign 0.00
R0347:Fnbp1l UTSW 3 122590175 missense probably damaging 1.00
R0382:Fnbp1l UTSW 3 122570953 splice site probably benign
R1401:Fnbp1l UTSW 3 122546306 missense probably damaging 0.97
R1746:Fnbp1l UTSW 3 122556491 missense probably benign
R1778:Fnbp1l UTSW 3 122590147 missense possibly damaging 0.89
R1861:Fnbp1l UTSW 3 122560932 missense probably damaging 1.00
R2202:Fnbp1l UTSW 3 122546962 missense probably benign 0.00
R3407:Fnbp1l UTSW 3 122552150 missense probably damaging 1.00
R3434:Fnbp1l UTSW 3 122546306 missense probably damaging 0.97
R4667:Fnbp1l UTSW 3 122556567 missense probably benign 0.04
R4771:Fnbp1l UTSW 3 122558103 missense possibly damaging 0.54
R4858:Fnbp1l UTSW 3 122546315 missense probably benign 0.30
R5163:Fnbp1l UTSW 3 122544663 missense probably benign 0.00
R6151:Fnbp1l UTSW 3 122570930 missense possibly damaging 0.89
R6153:Fnbp1l UTSW 3 122559156 missense probably benign 0.01
R6452:Fnbp1l UTSW 3 122544549 missense probably damaging 1.00
R6458:Fnbp1l UTSW 3 122556440 missense probably damaging 0.96
R6788:Fnbp1l UTSW 3 122546307 nonsense probably null
R7397:Fnbp1l UTSW 3 122544637 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACATCACACCAGGGAGGG -3'
(R):5'- ACACAAAGCAGTCTCGTGTTT -3'

Sequencing Primer
(F):5'- GTTAATAGCCATGGGAAGACTCTCC -3'
(R):5'- TTTGCCAGACCTGATCAGAG -3'
Posted On2015-04-17