Incidental Mutation 'R3947:C87436'
ID307748
Institutional Source Beutler Lab
Gene Symbol C87436
Ensembl Gene ENSMUSG00000046679
Gene Nameexpressed sequence C87436
Synonyms
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86438374-86473500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86446186 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 247 (H247Q)
Ref Sequence ENSEMBL: ENSMUSP00000115916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050497] [ENSMUST00000113698] [ENSMUST00000113700] [ENSMUST00000133753] [ENSMUST00000141972] [ENSMUST00000203568] [ENSMUST00000204137]
Predicted Effect probably damaging
Transcript: ENSMUST00000050497
AA Change: H247Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057461
Gene: ENSMUSG00000046679
AA Change: H247Q

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 1.1e-22 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113698
AA Change: H247Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109328
Gene: ENSMUSG00000046679
AA Change: H247Q

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 1e-22 PFAM
low complexity region 278 290 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113700
AA Change: H247Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109330
Gene: ENSMUSG00000046679
AA Change: H247Q

DomainStartEndE-ValueType
Pfam:zf-tcix 16 57 1.3e-22 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133753
AA Change: H247Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121520
Gene: ENSMUSG00000046679
AA Change: H247Q

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 6.2e-23 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141972
AA Change: H247Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115916
Gene: ENSMUSG00000046679
AA Change: H247Q

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 6.2e-23 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203568
SMART Domains Protein: ENSMUSP00000144724
Gene: ENSMUSG00000046679

DomainStartEndE-ValueType
Pfam:zf-tcix 16 57 3.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204137
Meta Mutation Damage Score 0.8427 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in C87436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:C87436 APN 6 86457855 missense probably damaging 1.00
IGL01596:C87436 APN 6 86446219 missense probably damaging 1.00
IGL02039:C87436 APN 6 86453695 missense probably benign 0.40
IGL02798:C87436 APN 6 86446202 missense probably benign 0.01
R0008:C87436 UTSW 6 86446283 unclassified probably benign
R0128:C87436 UTSW 6 86469827 missense probably damaging 1.00
R0445:C87436 UTSW 6 86449850 missense possibly damaging 0.77
R0970:C87436 UTSW 6 86447328 missense probably damaging 0.99
R1125:C87436 UTSW 6 86447362 missense probably benign 0.00
R1310:C87436 UTSW 6 86445450 missense possibly damaging 0.78
R1640:C87436 UTSW 6 86446251 missense probably damaging 0.99
R1764:C87436 UTSW 6 86453612 missense possibly damaging 0.92
R2213:C87436 UTSW 6 86445473 missense probably benign 0.04
R2275:C87436 UTSW 6 86445600 missense probably damaging 1.00
R5416:C87436 UTSW 6 86465850 missense probably damaging 1.00
R5604:C87436 UTSW 6 86447355 missense probably benign
R5982:C87436 UTSW 6 86445975 missense possibly damaging 0.87
R6171:C87436 UTSW 6 86445467 missense probably benign 0.04
R6744:C87436 UTSW 6 86446064 missense probably damaging 1.00
R7215:C87436 UTSW 6 86462680 missense possibly damaging 0.80
R7253:C87436 UTSW 6 86465808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCTGAATGCTCTGCAGG -3'
(R):5'- CTACGGGCTCTTAGAACATCCC -3'

Sequencing Primer
(F):5'- AATGCTCTGCAGGCTGCC -3'
(R):5'- CTTAGAACATCCCAAAGGTGCTGATG -3'
Posted On2015-04-17