Incidental Mutation 'R3947:Suclg2'
ID307749
Institutional Source Beutler Lab
Gene Symbol Suclg2
Ensembl Gene ENSMUSG00000061838
Gene Namesuccinate-Coenzyme A ligase, GDP-forming, beta subunit
SynonymsD6Wsu120e
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location95473009-95718800 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 95579238 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079847] [ENSMUST00000079847] [ENSMUST00000204224] [ENSMUST00000204224]
Predicted Effect probably null
Transcript: ENSMUST00000079847
SMART Domains Protein: ENSMUSP00000078774
Gene: ENSMUSG00000061838

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Pfam:ATP-grasp_5 33 263 1.1e-11 PFAM
Pfam:ATP-grasp_2 40 248 2.4e-79 PFAM
Pfam:Ligase_CoA 307 427 3.4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079847
SMART Domains Protein: ENSMUSP00000078774
Gene: ENSMUSG00000061838

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Pfam:ATP-grasp_5 33 263 1.1e-11 PFAM
Pfam:ATP-grasp_2 40 248 2.4e-79 PFAM
Pfam:Ligase_CoA 307 427 3.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203071
Predicted Effect probably null
Transcript: ENSMUST00000204224
SMART Domains Protein: ENSMUSP00000144827
Gene: ENSMUSG00000061838

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Pfam:ATP-grasp_5 33 263 1.1e-11 PFAM
Pfam:ATP-grasp_2 40 248 2.4e-79 PFAM
Pfam:Ligase_CoA 307 427 3.4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204224
SMART Domains Protein: ENSMUSP00000144827
Gene: ENSMUSG00000061838

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Pfam:ATP-grasp_5 33 263 1.1e-11 PFAM
Pfam:ATP-grasp_2 40 248 2.4e-79 PFAM
Pfam:Ligase_CoA 307 427 3.4e-28 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTP-specific beta subunit of succinyl-CoA synthetase. Succinyl-CoA synthetase catalyzes the reversible reaction involving the formation of succinyl-CoA and succinate. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 5 and 12. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous knockout with a gene trap is embryonic lethal. Heterozygosity has a mild effect on mitochondrial respiration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Suclg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Suclg2 APN 6 95579188 missense probably damaging 1.00
IGL01904:Suclg2 APN 6 95588934 splice site probably benign
IGL02245:Suclg2 APN 6 95595741 missense possibly damaging 0.54
IGL03268:Suclg2 APN 6 95569592 missense probably damaging 0.99
PIT4576001:Suclg2 UTSW 6 95587018 missense possibly damaging 0.95
R0173:Suclg2 UTSW 6 95475173 splice site probably benign
R1241:Suclg2 UTSW 6 95497582 splice site probably benign
R1654:Suclg2 UTSW 6 95655551 missense probably damaging 1.00
R1712:Suclg2 UTSW 6 95587016 missense probably damaging 1.00
R1929:Suclg2 UTSW 6 95589094 splice site probably benign
R3735:Suclg2 UTSW 6 95497696 missense probably damaging 1.00
R3736:Suclg2 UTSW 6 95497696 missense probably damaging 1.00
R3801:Suclg2 UTSW 6 95497668 missense probably damaging 0.98
R3803:Suclg2 UTSW 6 95497668 missense probably damaging 0.98
R3804:Suclg2 UTSW 6 95497668 missense probably damaging 0.98
R4768:Suclg2 UTSW 6 95566488 missense probably damaging 0.99
R4953:Suclg2 UTSW 6 95566436 missense probably damaging 1.00
R6140:Suclg2 UTSW 6 95569721 missense probably damaging 1.00
R7105:Suclg2 UTSW 6 95595654 missense possibly damaging 0.92
R7335:Suclg2 UTSW 6 95566460 missense probably damaging 1.00
R7335:Suclg2 UTSW 6 95566463 missense probably damaging 1.00
R7861:Suclg2 UTSW 6 95594722 missense probably benign 0.00
R8220:Suclg2 UTSW 6 95588946 missense possibly damaging 0.92
R8283:Suclg2 UTSW 6 95497719 critical splice acceptor site probably null
R8726:Suclg2 UTSW 6 95655508 missense probably damaging 1.00
R8840:Suclg2 UTSW 6 95569634 missense probably damaging 1.00
R8854:Suclg2 UTSW 6 95595669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAACTCAAAGCTGGTGCAG -3'
(R):5'- TCTGGAGGAAAGTTGAGCAGTC -3'

Sequencing Primer
(F):5'- CAGCTTTTGGAGATTATTTTGCAAG -3'
(R):5'- GAGCAGTCTGTTCTAATGAATAGCAG -3'
Posted On2015-04-17