Incidental Mutation 'R3947:Iqsec3'
ID307750
Institutional Source Beutler Lab
Gene Symbol Iqsec3
Ensembl Gene ENSMUSG00000040797
Gene NameIQ motif and Sec7 domain 3
SynonymssynarfGEF, BRAG3
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121372933-121473678 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 121387824 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 835 (Y835*)
Ref Sequence ENSEMBL: ENSMUSP00000038653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046373] [ENSMUST00000129815] [ENSMUST00000152103]
Predicted Effect probably null
Transcript: ENSMUST00000046373
AA Change: Y835*
SMART Domains Protein: ENSMUSP00000038653
Gene: ENSMUSG00000040797
AA Change: Y835*

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Blast:Sec7 285 354 5e-16 BLAST
low complexity region 367 386 N/A INTRINSIC
Blast:Sec7 476 507 2e-9 BLAST
low complexity region 508 531 N/A INTRINSIC
low complexity region 542 594 N/A INTRINSIC
low complexity region 598 628 N/A INTRINSIC
Sec7 652 843 9.53e-89 SMART
PH 874 985 4.03e0 SMART
low complexity region 1065 1105 N/A INTRINSIC
low complexity region 1126 1144 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
low complexity region 1182 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129815
SMART Domains Protein: ENSMUSP00000120847
Gene: ENSMUSG00000040797

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152103
SMART Domains Protein: ENSMUSP00000116317
Gene: ENSMUSG00000040797

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Iqsec3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Iqsec3 APN 6 121473124 missense possibly damaging 0.90
IGL01615:Iqsec3 APN 6 121410621 missense probably damaging 1.00
IGL01728:Iqsec3 APN 6 121412664 utr 3 prime probably benign
IGL01935:Iqsec3 APN 6 121383992 missense probably damaging 1.00
IGL02146:Iqsec3 APN 6 121383957 missense probably damaging 0.99
IGL02369:Iqsec3 APN 6 121412934 utr 3 prime probably benign
IGL02684:Iqsec3 APN 6 121412941 nonsense probably null
IGL03180:Iqsec3 APN 6 121413508 utr 3 prime probably benign
R0032:Iqsec3 UTSW 6 121473130 missense possibly damaging 0.71
R0088:Iqsec3 UTSW 6 121473289 missense probably damaging 0.97
R0189:Iqsec3 UTSW 6 121413562 utr 3 prime probably benign
R0193:Iqsec3 UTSW 6 121410724 missense probably damaging 1.00
R0528:Iqsec3 UTSW 6 121412784 utr 3 prime probably benign
R1885:Iqsec3 UTSW 6 121428367 intron probably benign
R2698:Iqsec3 UTSW 6 121413471 utr 3 prime probably benign
R3751:Iqsec3 UTSW 6 121376255 missense probably benign 0.19
R3753:Iqsec3 UTSW 6 121376255 missense probably benign 0.19
R3948:Iqsec3 UTSW 6 121387824 nonsense probably null
R3949:Iqsec3 UTSW 6 121387824 nonsense probably null
R4006:Iqsec3 UTSW 6 121376228 missense probably damaging 1.00
R4007:Iqsec3 UTSW 6 121376228 missense probably damaging 1.00
R4210:Iqsec3 UTSW 6 121413040 utr 3 prime probably benign
R4535:Iqsec3 UTSW 6 121380018 missense possibly damaging 0.80
R4567:Iqsec3 UTSW 6 121387762 missense probably damaging 1.00
R5096:Iqsec3 UTSW 6 121386698 missense probably damaging 1.00
R5135:Iqsec3 UTSW 6 121383919 missense probably damaging 1.00
R5289:Iqsec3 UTSW 6 121386700 critical splice acceptor site probably null
R5537:Iqsec3 UTSW 6 121412644 utr 3 prime probably benign
R6555:Iqsec3 UTSW 6 121384219 missense probably damaging 1.00
R6942:Iqsec3 UTSW 6 121473103 missense probably damaging 1.00
R7122:Iqsec3 UTSW 6 121473358 missense unknown
R7372:Iqsec3 UTSW 6 121384032 nonsense probably null
R7394:Iqsec3 UTSW 6 121386610 missense possibly damaging 0.47
R7559:Iqsec3 UTSW 6 121387780 missense probably damaging 1.00
R7729:Iqsec3 UTSW 6 121383981 missense probably damaging 1.00
R7815:Iqsec3 UTSW 6 121473358 missense probably benign 0.17
R8114:Iqsec3 UTSW 6 121413499 missense unknown
R8115:Iqsec3 UTSW 6 121473030 missense unknown
R8197:Iqsec3 UTSW 6 121413012 missense unknown
R8353:Iqsec3 UTSW 6 121387820 missense probably damaging 1.00
R8453:Iqsec3 UTSW 6 121387820 missense probably damaging 1.00
R8467:Iqsec3 UTSW 6 121381717 missense probably benign 0.28
R8500:Iqsec3 UTSW 6 121412854 utr 3 prime probably benign
R8514:Iqsec3 UTSW 6 121413562 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTCCGTGGCTAACAGAAAG -3'
(R):5'- AGCCAGTTGGTAAAGGTCAG -3'

Sequencing Primer
(F):5'- TCCGTGGCTAACAGAAAGAGAGTG -3'
(R):5'- GGTCAGAGGCAAAACTCAATC -3'
Posted On2015-04-17