Incidental Mutation 'R3947:Dyrk4'
ID307751
Institutional Source Beutler Lab
Gene Symbol Dyrk4
Ensembl Gene ENSMUSG00000030345
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
SynonymsDyrk4a, Dyrk4b
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126876020-126921839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126885305 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 408 (I408T)
Ref Sequence ENSEMBL: ENSMUSP00000077606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078521] [ENSMUST00000171945]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032495
Predicted Effect probably damaging
Transcript: ENSMUST00000078521
AA Change: I408T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077606
Gene: ENSMUSG00000030345
AA Change: I408T

DomainStartEndE-ValueType
S_TKc 219 515 2.9e-84 SMART
low complexity region 555 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171945
AA Change: I27T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128180
Gene: ENSMUSG00000030345
AA Change: I27T

DomainStartEndE-ValueType
Pfam:Pkinase 1 59 2.8e-14 PFAM
Meta Mutation Damage Score 0.7344 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to a conserved family of serine/threonine protein kinases. Members of this dual specificity kinase family are thought to function in the regulation of cell differentiation and proliferation, survival, and in development. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Contrary to expectation, homozygous null males are fertile and do not exhibit any obvious dysfunction in spermatogenesis, sperm motility and fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Dyrk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02474:Dyrk4 APN 6 126880231 missense probably damaging 1.00
IGL02598:Dyrk4 APN 6 126884019 intron probably benign
IGL02697:Dyrk4 APN 6 126899008 missense possibly damaging 0.88
IGL03127:Dyrk4 APN 6 126897171 missense possibly damaging 0.92
IGL03229:Dyrk4 APN 6 126886642 unclassified probably benign
IGL03248:Dyrk4 APN 6 126884053 missense probably benign 0.05
R0597:Dyrk4 UTSW 6 126886649 splice site probably null
R0862:Dyrk4 UTSW 6 126877333 missense possibly damaging 0.78
R0864:Dyrk4 UTSW 6 126877333 missense possibly damaging 0.78
R1470:Dyrk4 UTSW 6 126916374 nonsense probably null
R1470:Dyrk4 UTSW 6 126916374 nonsense probably null
R1645:Dyrk4 UTSW 6 126894793 nonsense probably null
R1650:Dyrk4 UTSW 6 126899829 missense probably benign 0.28
R1885:Dyrk4 UTSW 6 126877181 missense probably benign 0.15
R3948:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R3949:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R4794:Dyrk4 UTSW 6 126885337 missense possibly damaging 0.79
R5991:Dyrk4 UTSW 6 126880225 missense probably benign 0.44
R6143:Dyrk4 UTSW 6 126886651 critical splice donor site probably null
R6269:Dyrk4 UTSW 6 126886727 missense probably damaging 1.00
R6572:Dyrk4 UTSW 6 126897238 missense probably benign
R6598:Dyrk4 UTSW 6 126876326 missense probably benign 0.20
R6703:Dyrk4 UTSW 6 126890082 missense probably damaging 1.00
R6750:Dyrk4 UTSW 6 126898955 missense probably benign 0.00
R7214:Dyrk4 UTSW 6 126885237 missense probably benign 0.35
R7585:Dyrk4 UTSW 6 126890044 missense probably damaging 1.00
R8101:Dyrk4 UTSW 6 126891649 missense possibly damaging 0.87
R8203:Dyrk4 UTSW 6 126894834 missense probably damaging 1.00
R8769:Dyrk4 UTSW 6 126880245 missense possibly damaging 0.49
Z1176:Dyrk4 UTSW 6 126892128 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGATCACACTGGCTTCAG -3'
(R):5'- TTCCTGAGAAGCCCACAGAGAG -3'

Sequencing Primer
(F):5'- CTACTTTCAGAAGTGGAGGCATGTAC -3'
(R):5'- CAGAGAGGGAGGGGCCTTTATG -3'
Posted On2015-04-17