Mutagenetix > Incidental Mutations

Incidental Mutation 'R3947:Chst15'

307752

Institutional Source

Beutler Lab

Gene Symbol

Chst15

Ensembl Gene

ENSMUSG00000030930

Gene Name

carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15

Synonyms

MAd5, GalNAcS-6ST, MAd5, 4631426J05Rik

MMRRC Submission

040927-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R3947 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

132235780-132317228 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 132247875 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 446 (N446Y)

Ref Sequence

ENSEMBL: ENSMUSP00000079105 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077472] [ENSMUST00000080215] [ENSMUST00000124096]

AlphaFold

Q91XQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000077472
AA Change: N446Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076682
Gene: ENSMUSG00000030930
AA Change: N446Y

Domain	Start	End	E-Value	Type
transmembrane domain	80	102	N/A	INTRINSIC
Pfam:Sulfotransfer_3	254	502	4.2e-10	PFAM
Pfam:Sulfotransfer_1	369	524	1.1e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000080215
AA Change: N446Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079105
Gene: ENSMUSG00000030930
AA Change: N446Y

Domain	Start	End	E-Value	Type
transmembrane domain	80	102	N/A	INTRINSIC
Pfam:Sulfotransfer_3	254	499	7.9e-9	PFAM
Pfam:Sulfotransfer_1	369	524	1.2e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Meta Mutation Damage Score

0.2895

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (32/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size and abnormal bone marrow-derived mast cell morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	A	14: 54,679,333	Q133L	possibly damaging	Het
Adgrg4	C	T	X: 56,917,754	T1561I	probably benign	Het
Avl9	T	C	6: 56,728,665		probably null	Het
C87436	T	A	6: 86,446,186	H247Q	probably damaging	Het
Cfap43	G	T	19: 47,765,979	H969N	probably benign	Het
Col4a3	T	A	1: 82,715,332	I1446N	probably damaging	Het
Disc1	A	G	8: 125,088,135	E246G	probably damaging	Het
Dyrk4	A	G	6: 126,885,305	I408T	probably damaging	Het
Fnbp1l	G	T	3: 122,544,579	A481D	possibly damaging	Het
Gm10608	TACACACACACACACACACACACACACACACACACACACACACACACACACACACA	TACACACACACACACACACACACACACACACACACACACACACACACACA	9: 119,160,662		probably benign	Het
Grk2	G	A	19: 4,292,417	T129M	possibly damaging	Het
Ino80d	G	T	1: 63,074,503	Q263K	probably benign	Het
Iqsec3	A	T	6: 121,387,824	Y835*	probably null	Het
Irak3	T	A	10: 120,170,373	M213L	probably benign	Het
Macf1	T	C	4: 123,380,420	R6388G	probably damaging	Het
Mtnr1a	T	C	8: 45,087,520	Y173H	probably damaging	Het
Myo5b	C	T	18: 74,695,403	R709W	probably damaging	Het
Nebl	A	T	2: 17,378,106		probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr123	A	T	17: 37,796,115	I224L	probably benign	Het
Pex11g	G	A	8: 3,465,787	T82I	probably benign	Het
Pgr	A	G	9: 8,961,452	I842V	probably benign	Het
Pkd1	T	A	17: 24,578,037		probably benign	Het
Rbm20	T	C	19: 53,813,337	I92T	probably benign	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Ssh2	A	G	11: 77,398,256	D88G	probably damaging	Het
Suclg2	G	T	6: 95,579,238		probably null	Het
Tdrd3	A	T	14: 87,506,599	D655V	probably damaging	Het
Tex2	C	T	11: 106,520,003	D896N	unknown	Het
Tmem168	C	A	6: 13,583,052	R610L	probably damaging	Het
Ttc17	A	G	2: 94,376,146		probably benign	Het
Vmn2r99	T	C	17: 19,378,990	M312T	probably benign	Het
Wdfy3	T	C	5: 101,870,036	E2546G	probably damaging	Het

Other mutations in Chst15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01710:Chst15	APN	7	132270507	missense	probably benign	0.22
IGL01879:Chst15	APN	7	132270265	missense	possibly damaging	0.94
IGL02355:Chst15	APN	7	132266672	missense	probably benign	0.26
IGL02362:Chst15	APN	7	132266672	missense	probably benign	0.26
IGL02826:Chst15	APN	7	132266746	missense	probably damaging	1.00
IGL02860:Chst15	APN	7	132269102	missense	probably benign
IGL02972:Chst15	APN	7	132269173	missense	probably damaging	1.00
IGL03266:Chst15	APN	7	132270076	missense	probably damaging	1.00
IGL03331:Chst15	APN	7	132262713	missense	probably damaging	1.00
IGL03375:Chst15	APN	7	132270457	nonsense	probably null
R1476:Chst15	UTSW	7	132270273	missense	possibly damaging	0.95
R1501:Chst15	UTSW	7	132269069	nonsense	probably null
R1518:Chst15	UTSW	7	132270126	missense	probably damaging	1.00
R1943:Chst15	UTSW	7	132262850	splice site	probably null
R2164:Chst15	UTSW	7	132270385	missense	probably damaging	0.97
R4921:Chst15	UTSW	7	132247884	missense	probably benign	0.01
R5817:Chst15	UTSW	7	132269144	missense	probably damaging	0.99
R5817:Chst15	UTSW	7	132269147	missense	probably damaging	0.99
R5917:Chst15	UTSW	7	132270517	missense	probably benign
R6930:Chst15	UTSW	7	132269030	missense	possibly damaging	0.95
R7159:Chst15	UTSW	7	132270258	missense	probably damaging	1.00
R7911:Chst15	UTSW	7	132270522	missense	probably benign	0.12
R8282:Chst15	UTSW	7	132270150	missense	probably benign
R8342:Chst15	UTSW	7	132247886	missense	probably benign	0.15
R9011:Chst15	UTSW	7	132270517	missense	probably benign
R9093:Chst15	UTSW	7	132268917	critical splice donor site	probably null
R9329:Chst15	UTSW	7	132266791	missense	possibly damaging	0.46
R9352:Chst15	UTSW	7	132270528	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGATGCAAAGTTTCTGGGTG -3'
(R):5'- TCACACCCTCGGATGGTAAG -3'

Sequencing Primer
(F):5'- GGGAGCATTTTTCTTCCACATTAG -3'
(R):5'- ACCCTCGGATGGTAAGATTATCC -3'

Posted On

2015-04-17