Incidental Mutation 'R3947:Pex11g'
ID307753
Institutional Source Beutler Lab
Gene Symbol Pex11g
Ensembl Gene ENSMUSG00000069633
Gene Nameperoxisomal biogenesis factor 11 gamma
SynonymsPex11c, 1810049N02Rik, 1810022F11Rik, Pex11gamma
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3457105-3467680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3465787 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 82 (T82I)
Ref Sequence ENSEMBL: ENSMUSP00000004686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004686] [ENSMUST00000111081]
Predicted Effect probably benign
Transcript: ENSMUST00000004686
AA Change: T82I

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000004686
Gene: ENSMUSG00000069633
AA Change: T82I

DomainStartEndE-ValueType
Pfam:PEX11 4 230 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111081
SMART Domains Protein: ENSMUSP00000106710
Gene: ENSMUSG00000069633

DomainStartEndE-ValueType
Pfam:PEX11 1 151 4.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118194
SMART Domains Protein: ENSMUSP00000113294
Gene: ENSMUSG00000069633

DomainStartEndE-ValueType
Pfam:PEX11 4 144 3.1e-43 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PEX11 family. This family is reported to regulate the number and size of peroxisomes in evolutionarily distant organisms. The protein encoded by this gene may induce clustering of peroxisomes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Pex11g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Pex11g APN 8 3465898 missense probably benign 0.34
R4597:Pex11g UTSW 8 3464043 missense probably damaging 1.00
R4610:Pex11g UTSW 8 3465899 missense probably benign 0.03
R4898:Pex11g UTSW 8 3464042 missense probably damaging 1.00
R5576:Pex11g UTSW 8 3465875 missense probably damaging 1.00
R6317:Pex11g UTSW 8 3464092 missense probably damaging 1.00
R7195:Pex11g UTSW 8 3459237 missense probably benign 0.00
R8802:Pex11g UTSW 8 3457308 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGTTCTCTGTCCATCTAAACTCAG -3'
(R):5'- GTATTGCTGCCAGCTGATCG -3'

Sequencing Primer
(F):5'- CAGATGATCAGTTTACCTGCCTGG -3'
(R):5'- CAGCTGATCGGTGGGGTC -3'
Posted On2015-04-17