Incidental Mutation 'R3947:Mtnr1a'
ID307754
Institutional Source Beutler Lab
Gene Symbol Mtnr1a
Ensembl Gene ENSMUSG00000054764
Gene Namemelatonin receptor 1A
SynonymsMelR, Mel1a receptor
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45069137-45088506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45087520 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 173 (Y173H)
Ref Sequence ENSEMBL: ENSMUSP00000069872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067984]
Predicted Effect probably damaging
Transcript: ENSMUST00000067984
AA Change: Y173H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069872
Gene: ENSMUSG00000054764
AA Change: Y173H

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 315 1.8e-11 PFAM
Pfam:7TM_GPCR_Srsx 41 313 2.5e-10 PFAM
Pfam:7tm_1 47 298 5.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130141
SMART Domains Protein: ENSMUSP00000115764
Gene: ENSMUSG00000054764

DomainStartEndE-ValueType
Pfam:7tm_1 23 92 6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209488
Meta Mutation Damage Score 0.5528 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This receptor is a G-protein coupled, 7-transmembrane receptor that is responsible for melatonin effects on mammalian circadian rhythm and reproductive alterations affected by day length. The receptor is an integral membrane protein that is readily detectable and localized to two specific regions of the brain. The hypothalamic suprachiasmatic nucleus appears to be involved in circadian rhythm while the hypophysial pars tuberalis may be responsible for the reproductive effects of melatonin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal, with normal circadian functions. In vitro studies report the absence of inhibitory effects of melatonin on suprachiasma neuronal firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Mtnr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02965:Mtnr1a APN 8 45069382 missense probably damaging 0.97
IGL03230:Mtnr1a APN 8 45087398 missense probably damaging 1.00
R0149:Mtnr1a UTSW 8 45069315 missense probably benign
R0744:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0833:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0836:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0856:Mtnr1a UTSW 8 45087833 missense possibly damaging 0.86
R1445:Mtnr1a UTSW 8 45087745 missense probably benign 0.27
R1983:Mtnr1a UTSW 8 45087434 missense probably benign 0.01
R2444:Mtnr1a UTSW 8 45087658 nonsense probably null
R2884:Mtnr1a UTSW 8 45087268 missense probably benign 0.00
R4829:Mtnr1a UTSW 8 45085615 intron probably benign
R5681:Mtnr1a UTSW 8 45087937 missense possibly damaging 0.47
R7908:Mtnr1a UTSW 8 45087826 missense probably benign 0.22
R8742:Mtnr1a UTSW 8 45087683 missense probably benign 0.00
R8748:Mtnr1a UTSW 8 45085638 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCATTTCTAATGGGCTTGAG -3'
(R):5'- ACAAAGTTCCTGAAGTCCTGGG -3'

Sequencing Primer
(F):5'- GAGTGTCATCGGCTCGATATTCAAC -3'
(R):5'- CTGAAGTCCTGGGGCTTCAG -3'
Posted On2015-04-17