Incidental Mutation 'R3947:Pgr'
ID307756
Institutional Source Beutler Lab
Gene Symbol Pgr
Ensembl Gene ENSMUSG00000031870
Gene Nameprogesterone receptor
Synonyms9930019P03Rik, ENSMUSG00000074510, PR-A, PR-B, PR, NR3C3
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location8899833-8968611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8961452 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 842 (I842V)
Ref Sequence ENSEMBL: ENSMUSP00000140124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070463] [ENSMUST00000098986] [ENSMUST00000189181]
Predicted Effect probably benign
Transcript: ENSMUST00000070463
AA Change: I842V

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000063562
Gene: ENSMUSG00000031870
AA Change: I842V

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 244 265 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
ZnF_C4 557 628 1.29e-29 SMART
low complexity region 703 711 N/A INTRINSIC
HOLI 713 877 3.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098986
AA Change: I677V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096584
Gene: ENSMUSG00000031870
AA Change: I677V

DomainStartEndE-ValueType
low complexity region 79 100 N/A INTRINSIC
low complexity region 172 189 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
low complexity region 269 289 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C4 392 463 1.29e-29 SMART
low complexity region 538 546 N/A INTRINSIC
HOLI 548 712 3.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189181
AA Change: I842V

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140124
Gene: ENSMUSG00000031870
AA Change: I842V

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 244 265 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
ZnF_C4 557 628 1.29e-29 SMART
low complexity region 703 711 N/A INTRINSIC
HOLI 713 877 3.21e-34 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: This gene encodes a member of the steroid receptor superfamily. The encoded protein mediates the physiological effects of progesterone, which plays a central role in reproductive events associated with the establishment and maintenance of pregnancy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null female mice are sterile and exhibit ovulatory defects, uterine hyperplasia, and impaired mammary development. Females lacking only isoform A are infertile but show normal mammary development, while females lacking only isoform B are fertile but present with mammary developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Pgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Pgr APN 9 8903691 missense possibly damaging 0.71
IGL01772:Pgr APN 9 8946636 splice site probably benign
IGL01963:Pgr APN 9 8922668 missense probably damaging 0.97
IGL02033:Pgr APN 9 8965110 missense probably damaging 1.00
IGL02837:Pgr APN 9 8946638 splice site probably benign
IGL03070:Pgr APN 9 8903664 missense possibly damaging 0.86
IGL03300:Pgr APN 9 8961539 missense probably damaging 1.00
R0152:Pgr UTSW 9 8965022 missense probably benign 0.45
R0305:Pgr UTSW 9 8902087 splice site probably benign
R0317:Pgr UTSW 9 8965022 missense probably benign 0.45
R0467:Pgr UTSW 9 8900778 missense possibly damaging 0.92
R1673:Pgr UTSW 9 8902068 missense possibly damaging 0.71
R1711:Pgr UTSW 9 8922714 splice site probably null
R1928:Pgr UTSW 9 8903629 nonsense probably null
R1951:Pgr UTSW 9 8946953 splice site probably benign
R2023:Pgr UTSW 9 8958398 missense probably damaging 0.99
R2426:Pgr UTSW 9 8900717 missense probably damaging 0.98
R2967:Pgr UTSW 9 8901818 missense possibly damaging 0.86
R3105:Pgr UTSW 9 8958396 missense probably benign 0.02
R3440:Pgr UTSW 9 8922629 missense probably damaging 0.98
R3735:Pgr UTSW 9 8901533 missense probably damaging 0.99
R4398:Pgr UTSW 9 8903749 critical splice donor site probably null
R4497:Pgr UTSW 9 8958419 missense probably damaging 0.99
R4811:Pgr UTSW 9 8900843 nonsense probably null
R4907:Pgr UTSW 9 8947043 intron probably benign
R4996:Pgr UTSW 9 8900913 missense probably damaging 0.99
R5448:Pgr UTSW 9 8922637 missense probably benign 0.06
R5449:Pgr UTSW 9 8956343 missense possibly damaging 0.95
R5699:Pgr UTSW 9 8900599 start gained probably benign
R5764:Pgr UTSW 9 8900537 missense probably benign 0.00
R6057:Pgr UTSW 9 8902005 missense probably damaging 0.98
R6134:Pgr UTSW 9 8900739 missense possibly damaging 0.51
R6242:Pgr UTSW 9 8900979 missense probably benign
R6476:Pgr UTSW 9 8964838 splice site probably null
R6508:Pgr UTSW 9 8956289 missense probably damaging 1.00
R6604:Pgr UTSW 9 8946866 missense possibly damaging 0.73
R6715:Pgr UTSW 9 8964999 missense possibly damaging 0.93
R7444:Pgr UTSW 9 8946882 missense probably damaging 1.00
R7769:Pgr UTSW 9 8946855 missense possibly damaging 0.88
R7899:Pgr UTSW 9 8903742 missense probably benign 0.11
R8139:Pgr UTSW 9 8956340 missense possibly damaging 0.61
R8198:Pgr UTSW 9 8958410 missense possibly damaging 0.84
R8348:Pgr UTSW 9 8922601 missense probably benign 0.32
R8713:Pgr UTSW 9 8900817 missense possibly damaging 0.92
R8725:Pgr UTSW 9 8901543 missense probably damaging 0.99
R8727:Pgr UTSW 9 8901543 missense probably damaging 0.99
R8748:Pgr UTSW 9 8958448 missense probably benign 0.19
X0066:Pgr UTSW 9 8900834 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAAGACCTCTTTGGAGCAAATGC -3'
(R):5'- TTATAACAGTTGCCGTGGTCATGG -3'

Sequencing Primer
(F):5'- AAAAGTCTGAAATGTAAGTTGTTCAC -3'
(R):5'- TCATGGTGCCCCCTCACAG -3'
Posted On2015-04-17