Incidental Mutation 'R3947:Irak3'
ID307758
Institutional Source Beutler Lab
Gene Symbol Irak3
Ensembl Gene ENSMUSG00000020227
Gene Nameinterleukin-1 receptor-associated kinase 3
Synonyms4833428C18Rik, IRAK-M
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location120141648-120202130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120170373 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 213 (M213L)
Ref Sequence ENSEMBL: ENSMUSP00000020448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020448] [ENSMUST00000135106] [ENSMUST00000145665]
Predicted Effect probably benign
Transcript: ENSMUST00000020448
AA Change: M213L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020448
Gene: ENSMUSG00000020227
AA Change: M213L

DomainStartEndE-ValueType
Pfam:Death 26 106 1.3e-15 PFAM
Pfam:Pkinase 178 456 8.4e-37 PFAM
Pfam:Pkinase_Tyr 178 456 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135106
AA Change: M213L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123604
Gene: ENSMUSG00000020227
AA Change: M213L

DomainStartEndE-ValueType
Pfam:Death 26 106 2.2e-16 PFAM
Pfam:Pkinase_Tyr 178 301 3.1e-15 PFAM
Pfam:Pkinase 178 302 4.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143100
Predicted Effect probably benign
Transcript: ENSMUST00000145665
AA Change: M121L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118038
Gene: ENSMUSG00000020227
AA Change: M121L

DomainStartEndE-ValueType
Pfam:Pkinase 86 364 8.4e-35 PFAM
Pfam:Pkinase_Tyr 86 364 1.7e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220425
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interleukin-1 receptor-associated kinase protein family. Members of this family are essential components of the Toll/IL-R immune signal transduction pathways. This protein is primarily expressed in monocytes and macrophages and functions as a negative regulator of Toll-like receptor signaling. Mutations in this gene are associated with a susceptibility to asthma. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormal inflammatory responses to bacterial infections and loose bone mass with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Irak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Irak3 APN 10 120178067 critical splice donor site probably null
IGL01015:Irak3 APN 10 120142790 nonsense probably null
IGL01530:Irak3 APN 10 120142794 missense probably benign 0.10
IGL01641:Irak3 APN 10 120176347 missense probably benign 0.35
IGL01730:Irak3 APN 10 120178100 missense probably benign 0.04
IGL02054:Irak3 APN 10 120176259 missense probably benign 0.01
IGL02938:Irak3 APN 10 120182524 critical splice donor site probably null
IGL02954:Irak3 APN 10 120176242 missense probably damaging 0.98
IGL02992:Irak3 APN 10 120182661 missense probably damaging 1.00
IGL03376:Irak3 APN 10 120146636 splice site probably benign
iracema UTSW 10 120145782 missense probably damaging 0.99
R0031:Irak3 UTSW 10 120176320 nonsense probably null
R0734:Irak3 UTSW 10 120145637 splice site probably benign
R1017:Irak3 UTSW 10 120142884 missense possibly damaging 0.94
R1025:Irak3 UTSW 10 120176346 missense probably damaging 1.00
R1486:Irak3 UTSW 10 120143061 missense probably damaging 1.00
R1538:Irak3 UTSW 10 120165130 missense probably benign 0.00
R1596:Irak3 UTSW 10 120182546 missense probably damaging 1.00
R1689:Irak3 UTSW 10 120146552 missense probably damaging 0.98
R2133:Irak3 UTSW 10 120165177 missense probably benign 0.10
R3609:Irak3 UTSW 10 120145677 missense possibly damaging 0.95
R3948:Irak3 UTSW 10 120170373 missense probably benign 0.00
R4510:Irak3 UTSW 10 120145908 missense probably damaging 0.99
R4511:Irak3 UTSW 10 120145908 missense probably damaging 0.99
R4885:Irak3 UTSW 10 120182681 missense probably damaging 1.00
R5007:Irak3 UTSW 10 120146429 critical splice donor site probably null
R5180:Irak3 UTSW 10 120145782 missense probably damaging 0.99
R5704:Irak3 UTSW 10 120145689 missense probably benign 0.04
R5715:Irak3 UTSW 10 120142736 missense possibly damaging 0.66
R6020:Irak3 UTSW 10 120143137 missense probably damaging 1.00
R6916:Irak3 UTSW 10 120201365 missense probably damaging 1.00
R7182:Irak3 UTSW 10 120166511 missense probably damaging 1.00
R7707:Irak3 UTSW 10 120146584 missense probably damaging 0.99
R7787:Irak3 UTSW 10 120176351 missense probably benign 0.06
R8087:Irak3 UTSW 10 120182535 missense probably benign 0.02
R8673:Irak3 UTSW 10 120146588 missense possibly damaging 0.68
X0023:Irak3 UTSW 10 120143187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTTTAAGGAGAACACCAAAG -3'
(R):5'- TTCAGGGGAACGTTCTACTGAAG -3'

Sequencing Primer
(F):5'- CTTTAAGGAGAACACCAAAGCAGATG -3'
(R):5'- ACGTTCTACTGAAGAGTAATGGTTG -3'
Posted On2015-04-17