Incidental Mutation 'R3947:Tdrd3'
ID307763
Institutional Source Beutler Lab
Gene Symbol Tdrd3
Ensembl Gene ENSMUSG00000022019
Gene Nametudor domain containing 3
Synonyms4732418C03Rik
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location87416639-87545504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87506599 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 655 (D655V)
Ref Sequence ENSEMBL: ENSMUSP00000126189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168275] [ENSMUST00000169504] [ENSMUST00000170865]
Predicted Effect probably damaging
Transcript: ENSMUST00000168275
AA Change: D661V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129019
Gene: ENSMUSG00000022019
AA Change: D661V

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169504
AA Change: D661V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131542
Gene: ENSMUSG00000022019
AA Change: D661V

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170865
AA Change: D655V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126189
Gene: ENSMUSG00000022019
AA Change: D655V

DomainStartEndE-ValueType
DUF1767 3 82 1.36e-18 SMART
low complexity region 263 274 N/A INTRINSIC
UBA 282 319 1.67e-7 SMART
low complexity region 332 342 N/A INTRINSIC
low complexity region 440 454 N/A INTRINSIC
TUDOR 640 699 1.07e-7 SMART
Meta Mutation Damage Score 0.9172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Homozygous mice for a hypomorphic allele show increased genomic instability, and increased c-Myc/Igh translocation and R loop formation in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Tdrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Tdrd3 APN 14 87472182 missense probably damaging 1.00
IGL01339:Tdrd3 APN 14 87480794 missense possibly damaging 0.75
IGL01565:Tdrd3 APN 14 87472232 missense probably benign 0.01
IGL02505:Tdrd3 APN 14 87511682 missense probably damaging 1.00
R0121:Tdrd3 UTSW 14 87539479 missense probably damaging 1.00
R0550:Tdrd3 UTSW 14 87486220 missense probably damaging 1.00
R0648:Tdrd3 UTSW 14 87472182 missense probably damaging 1.00
R1080:Tdrd3 UTSW 14 87506398 missense probably benign 0.00
R1099:Tdrd3 UTSW 14 87487239 missense probably damaging 1.00
R1126:Tdrd3 UTSW 14 87480774 missense probably damaging 1.00
R1370:Tdrd3 UTSW 14 87458054 intron probably benign
R1592:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R1881:Tdrd3 UTSW 14 87486347 splice site probably null
R2096:Tdrd3 UTSW 14 87506352 nonsense probably null
R2162:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3833:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R4421:Tdrd3 UTSW 14 87486283 missense probably damaging 1.00
R4783:Tdrd3 UTSW 14 87472101 missense probably damaging 1.00
R4957:Tdrd3 UTSW 14 87505787 missense probably benign 0.06
R5212:Tdrd3 UTSW 14 87506215 missense probably damaging 0.98
R5291:Tdrd3 UTSW 14 87505798 missense probably benign 0.21
R5318:Tdrd3 UTSW 14 87477463 critical splice donor site probably null
R5383:Tdrd3 UTSW 14 87480791 nonsense probably null
R5718:Tdrd3 UTSW 14 87506440 missense probably benign 0.05
R6240:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R6292:Tdrd3 UTSW 14 87506254 missense probably benign
R6532:Tdrd3 UTSW 14 87505816 missense probably damaging 0.98
R6850:Tdrd3 UTSW 14 87458079 intron probably benign
R6958:Tdrd3 UTSW 14 87457096 missense probably damaging 1.00
R7224:Tdrd3 UTSW 14 87477403 missense probably damaging 1.00
R7240:Tdrd3 UTSW 14 87458803 missense probably benign 0.06
R7565:Tdrd3 UTSW 14 87506593 nonsense probably null
R7818:Tdrd3 UTSW 14 87472200 missense probably damaging 1.00
R7861:Tdrd3 UTSW 14 87472154 missense probably damaging 1.00
R8108:Tdrd3 UTSW 14 87486266 missense possibly damaging 0.95
R8206:Tdrd3 UTSW 14 87511778 missense probably benign 0.11
R8383:Tdrd3 UTSW 14 87506308 missense probably benign 0.26
R8786:Tdrd3 UTSW 14 87472201 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACCGATTAAGTCAGCAGG -3'
(R):5'- CTGCGTGAACTATGGCTGAAC -3'

Sequencing Primer
(F):5'- AGGACCTGTCACAGCTGTG -3'
(R):5'- GAGTACCACGAGAATATTGC -3'
Posted On2015-04-17