Incidental Mutation 'R3947:Vmn2r99'
ID 307764
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Name vomeronasal 2, receptor 99
Synonyms EG665376
MMRRC Submission 040927-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R3947 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 19582397-19614852 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19599252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 312 (M312T)
Ref Sequence ENSEMBL: ENSMUSP00000156067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
AlphaFold H3BK37
Predicted Effect probably benign
Transcript: ENSMUST00000176107
AA Change: M312T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: M312T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
AA Change: M312T

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,916,790 (GRCm39) Q133L possibly damaging Het
Adgrg4 C T X: 55,963,114 (GRCm39) T1561I probably benign Het
Avl9 T C 6: 56,705,650 (GRCm39) probably null Het
C87436 T A 6: 86,423,168 (GRCm39) H247Q probably damaging Het
Cfap43 G T 19: 47,754,418 (GRCm39) H969N probably benign Het
Chst15 T A 7: 131,849,604 (GRCm39) N446Y probably damaging Het
Col4a3 T A 1: 82,693,053 (GRCm39) I1446N probably damaging Het
Disc1 A G 8: 125,814,874 (GRCm39) E246G probably damaging Het
Dyrk4 A G 6: 126,862,268 (GRCm39) I408T probably damaging Het
Fnbp1l G T 3: 122,338,228 (GRCm39) A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 118,989,730 (GRCm39) probably benign Het
Grk2 G A 19: 4,342,445 (GRCm39) T129M possibly damaging Het
Ino80d G T 1: 63,113,662 (GRCm39) Q263K probably benign Het
Iqsec3 A T 6: 121,364,783 (GRCm39) Y835* probably null Het
Irak3 T A 10: 120,006,278 (GRCm39) M213L probably benign Het
Macf1 T C 4: 123,274,213 (GRCm39) R6388G probably damaging Het
Mtnr1a T C 8: 45,540,557 (GRCm39) Y173H probably damaging Het
Myo5b C T 18: 74,828,474 (GRCm39) R709W probably damaging Het
Nebl A T 2: 17,382,917 (GRCm39) probably null Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or2g1 A T 17: 38,107,006 (GRCm39) I224L probably benign Het
Pex11g G A 8: 3,515,787 (GRCm39) T82I probably benign Het
Pgr A G 9: 8,961,453 (GRCm39) I842V probably benign Het
Pkd1 T A 17: 24,797,011 (GRCm39) probably benign Het
Rbm20 T C 19: 53,801,768 (GRCm39) I92T probably benign Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Ssh2 A G 11: 77,289,082 (GRCm39) D88G probably damaging Het
Suclg2 G T 6: 95,556,219 (GRCm39) probably null Het
Tdrd3 A T 14: 87,744,035 (GRCm39) D655V probably damaging Het
Tex2 C T 11: 106,410,829 (GRCm39) D896N unknown Het
Tmem168 C A 6: 13,583,051 (GRCm39) R610L probably damaging Het
Ttc17 A G 2: 94,206,491 (GRCm39) probably benign Het
Wdfy3 T C 5: 102,017,902 (GRCm39) E2546G probably damaging Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19,599,116 (GRCm39) missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19,614,518 (GRCm39) missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19,602,885 (GRCm39) missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19,613,920 (GRCm39) splice site probably benign
IGL01769:Vmn2r99 APN 17 19,600,377 (GRCm39) missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19,600,494 (GRCm39) missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19,598,952 (GRCm39) nonsense probably null
IGL03132:Vmn2r99 APN 17 19,598,485 (GRCm39) nonsense probably null
FR4548:Vmn2r99 UTSW 17 19,614,547 (GRCm39) missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19,614,547 (GRCm39) missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19,614,605 (GRCm39) missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19,614,835 (GRCm39) missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19,599,305 (GRCm39) missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19,582,521 (GRCm39) missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19,600,322 (GRCm39) missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19,582,514 (GRCm39) missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19,598,207 (GRCm39) missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19,582,415 (GRCm39) missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19,599,077 (GRCm39) missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19,598,253 (GRCm39) missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19,598,891 (GRCm39) missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19,598,970 (GRCm39) missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19,614,635 (GRCm39) missense possibly damaging 0.92
R3949:Vmn2r99 UTSW 17 19,599,252 (GRCm39) missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19,598,832 (GRCm39) missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19,599,522 (GRCm39) missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19,613,924 (GRCm39) missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19,582,397 (GRCm39) start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19,598,868 (GRCm39) missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19,599,601 (GRCm39) missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19,599,531 (GRCm39) missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19,614,408 (GRCm39) nonsense probably null
R6021:Vmn2r99 UTSW 17 19,598,210 (GRCm39) missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19,599,242 (GRCm39) missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19,602,820 (GRCm39) missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19,602,820 (GRCm39) missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19,602,867 (GRCm39) missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19,600,293 (GRCm39) missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19,600,296 (GRCm39) missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19,600,457 (GRCm39) missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19,598,372 (GRCm39) missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19,614,826 (GRCm39) nonsense probably null
R7090:Vmn2r99 UTSW 17 19,613,972 (GRCm39) missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19,599,573 (GRCm39) missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19,599,407 (GRCm39) missense probably benign 0.01
R7789:Vmn2r99 UTSW 17 19,614,079 (GRCm39) missense possibly damaging 0.91
R8039:Vmn2r99 UTSW 17 19,600,302 (GRCm39) missense probably benign 0.00
R8493:Vmn2r99 UTSW 17 19,614,020 (GRCm39) missense probably benign 0.15
R8511:Vmn2r99 UTSW 17 19,614,443 (GRCm39) missense probably damaging 1.00
R8715:Vmn2r99 UTSW 17 19,613,922 (GRCm39) critical splice acceptor site probably benign
R9462:Vmn2r99 UTSW 17 19,598,388 (GRCm39) nonsense probably null
R9681:Vmn2r99 UTSW 17 19,598,889 (GRCm39) missense probably damaging 1.00
R9737:Vmn2r99 UTSW 17 19,582,563 (GRCm39) missense probably benign
Z1088:Vmn2r99 UTSW 17 19,599,563 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCCACATGGACTTCATATTTTGC -3'
(R):5'- CCCATCAAATATGTGACGAGGG -3'

Sequencing Primer
(F):5'- TGCCAAATTCTGGGAAAATATGG -3'
(R):5'- CATCCAAAGAAGCATTGGTTTGACAG -3'
Posted On 2015-04-17