Mutagenetix > Incidental Mutation

Incidental Mutation 'R3947:Pkd1'

307765

Institutional Source

Beutler Lab

Gene Symbol

Pkd1

Ensembl Gene

ENSMUSG00000032855

Gene Name

polycystin 1, transient receptor poteintial channel interacting

Synonyms

PC-1, polycystin-1, PC1

MMRRC Submission

040927-MU

Accession Numbers

Ncbi RefSeq: NM_013630.2; MGI:97603

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3947 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24549834-24596508 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 24578037 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000226883]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035565

SMART Domains

Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
LRRNT	32	71	1.61e-8	SMART
LRR_TYP	90	113	2.47e-5	SMART
LRRCT	125	177	3.84e-12	SMART
WSC	177	271	6.93e-34	SMART
PKD	272	355	2.72e-15	SMART
CLECT	406	530	5.72e-20	SMART
low complexity region	545	558	N/A	INTRINSIC
low complexity region	763	788	N/A	INTRINSIC
PKD	930	1008	1.06e-8	SMART
PKD	1015	1119	2.26e-12	SMART
PKD	1122	1205	2.03e-14	SMART
PKD	1208	1288	1.14e-17	SMART
PKD	1290	1373	2.35e-10	SMART
PKD	1374	1459	7.63e-10	SMART
PKD	1464	1541	1.95e-16	SMART
PKD	1544	1625	1.05e-16	SMART
PKD	1631	1714	1.93e-1	SMART
PKD	1716	1798	2.21e-15	SMART
PKD	1799	1882	5.7e-9	SMART
PKD	1884	1964	1.56e-6	SMART
PKD	1968	2056	3.1e-10	SMART
PKD	2057	2140	1.74e-13	SMART
Pfam:REJ	2167	2610	1e-108	PFAM
low complexity region	2697	2706	N/A	INTRINSIC
GPS	3003	3052	1.33e-12	SMART
transmembrane domain	3065	3087	N/A	INTRINSIC
LH2	3110	3224	3.5e-18	SMART
transmembrane domain	3275	3294	N/A	INTRINSIC
transmembrane domain	3314	3336	N/A	INTRINSIC
low complexity region	3357	3378	N/A	INTRINSIC
low complexity region	3479	3492	N/A	INTRINSIC
transmembrane domain	3547	3569	N/A	INTRINSIC
low complexity region	3573	3591	N/A	INTRINSIC
low complexity region	3626	3639	N/A	INTRINSIC
low complexity region	3661	3676	N/A	INTRINSIC
Pfam:PKD_channel	3701	4103	7.1e-125	PFAM
low complexity region	4153	4172	N/A	INTRINSIC
low complexity region	4238	4256	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226178

Predicted Effect

probably benign
Transcript: ENSMUST00000226883

Predicted Effect

probably benign
Transcript: ENSMUST00000227107

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (32/33)

MGI Phenotype

Strain: Several; see below
Lethality: E13-E15
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]

Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	A	14: 54,679,333	Q133L	possibly damaging	Het
Adgrg4	C	T	X: 56,917,754	T1561I	probably benign	Het
Avl9	T	C	6: 56,728,665		probably null	Het
C87436	T	A	6: 86,446,186	H247Q	probably damaging	Het
Cfap43	G	T	19: 47,765,979	H969N	probably benign	Het
Chst15	T	A	7: 132,247,875	N446Y	probably damaging	Het
Col4a3	T	A	1: 82,715,332	I1446N	probably damaging	Het
Disc1	A	G	8: 125,088,135	E246G	probably damaging	Het
Dyrk4	A	G	6: 126,885,305	I408T	probably damaging	Het
Fnbp1l	G	T	3: 122,544,579	A481D	possibly damaging	Het
Gm10608	TACACACACACACACACACACACACACACACACACACACACACACACACACACACA	TACACACACACACACACACACACACACACACACACACACACACACACACA	9: 119,160,662		probably benign	Het
Grk2	G	A	19: 4,292,417	T129M	possibly damaging	Het
Ino80d	G	T	1: 63,074,503	Q263K	probably benign	Het
Iqsec3	A	T	6: 121,387,824	Y835*	probably null	Het
Irak3	T	A	10: 120,170,373	M213L	probably benign	Het
Macf1	T	C	4: 123,380,420	R6388G	probably damaging	Het
Mtnr1a	T	C	8: 45,087,520	Y173H	probably damaging	Het
Myo5b	C	T	18: 74,695,403	R709W	probably damaging	Het
Nebl	A	T	2: 17,378,106		probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr123	A	T	17: 37,796,115	I224L	probably benign	Het
Pex11g	G	A	8: 3,465,787	T82I	probably benign	Het
Pgr	A	G	9: 8,961,452	I842V	probably benign	Het
Rbm20	T	C	19: 53,813,337	I92T	probably benign	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Ssh2	A	G	11: 77,398,256	D88G	probably damaging	Het
Suclg2	G	T	6: 95,579,238		probably null	Het
Tdrd3	A	T	14: 87,506,599	D655V	probably damaging	Het
Tex2	C	T	11: 106,520,003	D896N	unknown	Het
Tmem168	C	A	6: 13,583,052	R610L	probably damaging	Het
Ttc17	A	G	2: 94,376,146		probably benign	Het
Vmn2r99	T	C	17: 19,378,990	M312T	probably benign	Het
Wdfy3	T	C	5: 101,870,036	E2546G	probably damaging	Het

Other mutations in Pkd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Pkd1	APN	17	24580095	missense	probably damaging	1.00
IGL00503:Pkd1	APN	17	24565427	missense	probably benign
IGL00549:Pkd1	APN	17	24572761	missense	probably benign
IGL00573:Pkd1	APN	17	24594530	nonsense	probably null
IGL00924:Pkd1	APN	17	24571627	nonsense	probably null
IGL01319:Pkd1	APN	17	24587919	unclassified	probably benign
IGL01326:Pkd1	APN	17	24576174	nonsense	probably null
IGL01457:Pkd1	APN	17	24594821	splice site	probably null
IGL01541:Pkd1	APN	17	24586298	missense	probably damaging	1.00
IGL01575:Pkd1	APN	17	24573128	missense	probably damaging	1.00
IGL01606:Pkd1	APN	17	24576523	missense	probably damaging	0.97
IGL01642:Pkd1	APN	17	24581292	missense	probably damaging	1.00
IGL01888:Pkd1	APN	17	24585815	missense	possibly damaging	0.91
IGL01940:Pkd1	APN	17	24579746	missense	possibly damaging	0.63
IGL01958:Pkd1	APN	17	24580324	missense	probably damaging	1.00
IGL02005:Pkd1	APN	17	24586004	missense	possibly damaging	0.67
IGL02121:Pkd1	APN	17	24575927	missense	probably benign	0.03
IGL02148:Pkd1	APN	17	24579836	missense	probably damaging	1.00
IGL02409:Pkd1	APN	17	24573623	missense	probably benign	0.01
IGL02442:Pkd1	APN	17	24565226	missense	probably benign	0.41
IGL02498:Pkd1	APN	17	24585779	missense	possibly damaging	0.91
IGL02501:Pkd1	APN	17	24569699	missense	probably benign	0.01
IGL02551:Pkd1	APN	17	24573815	missense	probably damaging	1.00
IGL02635:Pkd1	APN	17	24572811	missense	probably damaging	1.00
IGL02673:Pkd1	APN	17	24571283	missense	probably benign	0.40
IGL02808:Pkd1	APN	17	24593504	missense	probably damaging	1.00
IGL02816:Pkd1	APN	17	24594515	missense	probably benign	0.00
IGL02863:Pkd1	APN	17	24569752	missense	possibly damaging	0.56
IGL02927:Pkd1	APN	17	24575189	missense	probably damaging	1.00
IGL02961:Pkd1	APN	17	24578115	missense	possibly damaging	0.81
IGL03003:Pkd1	APN	17	24593603	critical splice donor site	probably null
IGL03066:Pkd1	APN	17	24586234	missense	probably damaging	1.00
IGL03182:Pkd1	APN	17	24573818	missense	probably damaging	0.98
IGL03384:Pkd1	APN	17	24565897	missense	probably benign	0.00
IGL03404:Pkd1	APN	17	24564406	missense	probably damaging	0.97
PIT1430001:Pkd1	UTSW	17	24569511	missense	probably damaging	0.99
PIT4494001:Pkd1	UTSW	17	24577801	missense	probably damaging	1.00
PIT4677001:Pkd1	UTSW	17	24574029	missense	possibly damaging	0.94
R0017:Pkd1	UTSW	17	24578539	critical splice donor site	probably null
R0017:Pkd1	UTSW	17	24578539	critical splice donor site	probably null
R0022:Pkd1	UTSW	17	24594819	missense	probably damaging	0.98
R0022:Pkd1	UTSW	17	24594819	missense	probably damaging	0.98
R0058:Pkd1	UTSW	17	24564703	missense	probably benign	0.06
R0058:Pkd1	UTSW	17	24564703	missense	probably benign	0.06
R0085:Pkd1	UTSW	17	24586223	missense	probably damaging	0.98
R0094:Pkd1	UTSW	17	24581276	missense	possibly damaging	0.80
R0094:Pkd1	UTSW	17	24581276	missense	possibly damaging	0.80
R0135:Pkd1	UTSW	17	24565071	missense	possibly damaging	0.85
R0304:Pkd1	UTSW	17	24585946	missense	probably damaging	1.00
R0427:Pkd1	UTSW	17	24593502	missense	probably damaging	0.98
R0502:Pkd1	UTSW	17	24574792	missense	probably damaging	0.99
R0518:Pkd1	UTSW	17	24595219	missense	probably benign	0.01
R0521:Pkd1	UTSW	17	24595219	missense	probably benign	0.01
R0544:Pkd1	UTSW	17	24585683	missense	probably damaging	1.00
R0546:Pkd1	UTSW	17	24580138	missense	probably benign	0.44
R0626:Pkd1	UTSW	17	24575575	missense	probably damaging	0.96
R0648:Pkd1	UTSW	17	24594937	missense	probably damaging	1.00
R1138:Pkd1	UTSW	17	24586032	missense	probably damaging	1.00
R1302:Pkd1	UTSW	17	24568236	missense	probably benign	0.00
R1306:Pkd1	UTSW	17	24573172	missense	probably damaging	0.97
R1349:Pkd1	UTSW	17	24575266	missense	probably damaging	1.00
R1372:Pkd1	UTSW	17	24575266	missense	probably damaging	1.00
R1437:Pkd1	UTSW	17	24595132	missense	probably damaging	1.00
R1515:Pkd1	UTSW	17	24594853	missense	probably benign	0.01
R1605:Pkd1	UTSW	17	24577526	missense	possibly damaging	0.95
R1622:Pkd1	UTSW	17	24581640	missense	probably benign
R1623:Pkd1	UTSW	17	24578269	missense	probably damaging	0.99
R1726:Pkd1	UTSW	17	24564176	missense	probably damaging	0.96
R1756:Pkd1	UTSW	17	24594485	missense	probably damaging	1.00
R1780:Pkd1	UTSW	17	24581569	missense	probably benign
R1785:Pkd1	UTSW	17	24591099	missense	probably benign	0.00
R1829:Pkd1	UTSW	17	24565584	missense	probably benign
R1869:Pkd1	UTSW	17	24594931	missense	probably damaging	1.00
R1920:Pkd1	UTSW	17	24595157	missense	probably damaging	0.99
R1922:Pkd1	UTSW	17	24595157	missense	probably damaging	0.99
R1987:Pkd1	UTSW	17	24576592	splice site	probably null
R1988:Pkd1	UTSW	17	24576592	splice site	probably null
R1998:Pkd1	UTSW	17	24573014	missense	probably damaging	1.00
R2007:Pkd1	UTSW	17	24579785	missense	probably damaging	1.00
R2019:Pkd1	UTSW	17	24568684	nonsense	probably null
R2054:Pkd1	UTSW	17	24574796	missense	probably benign	0.00
R2061:Pkd1	UTSW	17	24569914	missense	possibly damaging	0.89
R2196:Pkd1	UTSW	17	24580072	missense	possibly damaging	0.60
R2203:Pkd1	UTSW	17	24580889	missense	probably benign	0.01
R2301:Pkd1	UTSW	17	24574612	missense	probably benign
R2655:Pkd1	UTSW	17	24576490	missense	probably damaging	0.99
R2860:Pkd1	UTSW	17	24565446	missense	probably benign	0.43
R2861:Pkd1	UTSW	17	24565446	missense	probably benign	0.43
R3000:Pkd1	UTSW	17	24594486	missense	probably damaging	1.00
R3150:Pkd1	UTSW	17	24579791	missense	probably benign	0.00
R3747:Pkd1	UTSW	17	24591461	missense	possibly damaging	0.67
R3812:Pkd1	UTSW	17	24565641	missense	probably benign	0.00
R3859:Pkd1	UTSW	17	24578092	splice site	probably benign
R3893:Pkd1	UTSW	17	24572110	critical splice donor site	probably null
R3949:Pkd1	UTSW	17	24578037	splice site	probably benign
R4176:Pkd1	UTSW	17	24587997	missense	probably benign	0.17
R4199:Pkd1	UTSW	17	24570030	missense	probably benign	0.41
R4225:Pkd1	UTSW	17	24593523	missense	possibly damaging	0.50
R4439:Pkd1	UTSW	17	24585692	missense	probably damaging	1.00
R4476:Pkd1	UTSW	17	24576526	missense	probably damaging	1.00
R4716:Pkd1	UTSW	17	24576133	missense	probably damaging	1.00
R4801:Pkd1	UTSW	17	24578096	missense	probably damaging	1.00
R4802:Pkd1	UTSW	17	24578096	missense	probably damaging	1.00
R4817:Pkd1	UTSW	17	24565374	splice site	probably null
R4903:Pkd1	UTSW	17	24572002	missense	probably benign	0.30
R4910:Pkd1	UTSW	17	24572687	missense	probably damaging	1.00
R4964:Pkd1	UTSW	17	24586068	critical splice donor site	probably null
R4966:Pkd1	UTSW	17	24586068	critical splice donor site	probably null
R5040:Pkd1	UTSW	17	24571260	missense	probably benign	0.02
R5042:Pkd1	UTSW	17	24569887	missense	probably benign	0.00
R5088:Pkd1	UTSW	17	24590838	missense	possibly damaging	0.94
R5121:Pkd1	UTSW	17	24573463	missense	probably benign
R5296:Pkd1	UTSW	17	24576074	missense	probably damaging	1.00
R5338:Pkd1	UTSW	17	24594536	missense	probably benign
R5356:Pkd1	UTSW	17	24593577	missense	probably damaging	0.97
R5357:Pkd1	UTSW	17	24565790	missense	probably damaging	1.00
R5363:Pkd1	UTSW	17	24565073	missense	probably benign
R5383:Pkd1	UTSW	17	24574375	missense	probably benign
R5622:Pkd1	UTSW	17	24574040	missense	possibly damaging	0.67
R5651:Pkd1	UTSW	17	24591387	missense	possibly damaging	0.88
R5664:Pkd1	UTSW	17	24569371	missense	probably damaging	0.99
R5723:Pkd1	UTSW	17	24565523	missense	probably benign	0.01
R5797:Pkd1	UTSW	17	24592641	missense	possibly damaging	0.55
R5838:Pkd1	UTSW	17	24580212	missense	possibly damaging	0.75
R5866:Pkd1	UTSW	17	24580961	missense	probably damaging	0.99
R5873:Pkd1	UTSW	17	24569830	missense	probably benign
R5906:Pkd1	UTSW	17	24572920	missense	probably benign	0.16
R6047:Pkd1	UTSW	17	24595085	missense	probably damaging	1.00
R6076:Pkd1	UTSW	17	24581030	missense	probably benign	0.14
R6151:Pkd1	UTSW	17	24575606	missense	probably benign	0.00
R6252:Pkd1	UTSW	17	24581226	missense	probably damaging	0.98
R6341:Pkd1	UTSW	17	24580227	missense	probably damaging	1.00
R6540:Pkd1	UTSW	17	24575977	missense	probably damaging	1.00
R6732:Pkd1	UTSW	17	24569413	missense	probably damaging	1.00
R6836:Pkd1	UTSW	17	24581259	missense	probably damaging	1.00
R6856:Pkd1	UTSW	17	24573493	missense	probably benign	0.05
R6865:Pkd1	UTSW	17	24576487	missense	probably benign	0.43
R6999:Pkd1	UTSW	17	24578501	missense	possibly damaging	0.62
R7077:Pkd1	UTSW	17	24591119	missense	probably damaging	1.00
R7123:Pkd1	UTSW	17	24594768	missense	possibly damaging	0.89
R7134:Pkd1	UTSW	17	24594112	missense	probably damaging	0.99
R7210:Pkd1	UTSW	17	24575866	missense	probably damaging	0.98
R7323:Pkd1	UTSW	17	24575051	missense	probably benign	0.01
R7380:Pkd1	UTSW	17	24581642	missense	probably damaging	1.00
R7407:Pkd1	UTSW	17	24594594	missense	probably damaging	1.00
R7410:Pkd1	UTSW	17	24575881	missense	probably damaging	1.00
R7492:Pkd1	UTSW	17	24569741	missense	probably benign	0.04
R7517:Pkd1	UTSW	17	24580419	missense	probably damaging	1.00
R7543:Pkd1	UTSW	17	24595253	missense	probably damaging	0.99
R7560:Pkd1	UTSW	17	24573631	missense	probably benign	0.33
R7615:Pkd1	UTSW	17	24593502	missense	probably damaging	0.98
R7714:Pkd1	UTSW	17	24550276	missense	unknown
R7718:Pkd1	UTSW	17	24586500	missense	probably benign	0.15
R7731:Pkd1	UTSW	17	24573898	missense	probably damaging	1.00
R7849:Pkd1	UTSW	17	24586200	missense	probably damaging	0.98
R7859:Pkd1	UTSW	17	24571280	missense	probably damaging	1.00
R7866:Pkd1	UTSW	17	24590907	missense	probably benign	0.26
R7915:Pkd1	UTSW	17	24592656	nonsense	probably null
R7991:Pkd1	UTSW	17	24572621	missense	possibly damaging	0.95
R8050:Pkd1	UTSW	17	24565643	missense	probably benign	0.26
R8086:Pkd1	UTSW	17	24581214	missense	probably damaging	1.00
R8312:Pkd1	UTSW	17	24567128	missense	probably benign	0.02
R8385:Pkd1	UTSW	17	24575728	missense	possibly damaging	0.67
R8393:Pkd1	UTSW	17	24572647	missense	probably damaging	0.99
R8552:Pkd1	UTSW	17	24591469	missense	probably damaging	1.00
R8753:Pkd1	UTSW	17	24574202	missense	probably damaging	1.00
R8822:Pkd1	UTSW	17	24565641	missense	probably benign	0.00
R8855:Pkd1	UTSW	17	24573077	missense	probably damaging	1.00
R8866:Pkd1	UTSW	17	24573077	missense	probably damaging	1.00
R8867:Pkd1	UTSW	17	24573833	missense	probably damaging	1.00
R8960:Pkd1	UTSW	17	24576202	missense	probably damaging	1.00
R8966:Pkd1	UTSW	17	24575777	missense	possibly damaging	0.69
R9004:Pkd1	UTSW	17	24580447	missense	probably benign
R9015:Pkd1	UTSW	17	24565662	nonsense	probably null
R9069:Pkd1	UTSW	17	24573014	missense	probably damaging	1.00
R9092:Pkd1	UTSW	17	24569373	missense	possibly damaging	0.93
R9135:Pkd1	UTSW	17	24572002	missense
R9307:Pkd1	UTSW	17	24550477	missense	possibly damaging	0.90
R9312:Pkd1	UTSW	17	24578390	missense	probably damaging	1.00
R9313:Pkd1	UTSW	17	24594958	missense	probably damaging	1.00
R9380:Pkd1	UTSW	17	24550288	missense	unknown
R9383:Pkd1	UTSW	17	24575926	missense	probably damaging	1.00
R9531:Pkd1	UTSW	17	24573140	missense	probably damaging	0.99
R9617:Pkd1	UTSW	17	24581367	missense	probably damaging	1.00
R9691:Pkd1	UTSW	17	24577838	missense	possibly damaging	0.77
R9792:Pkd1	UTSW	17	24581198	missense	probably benign
R9793:Pkd1	UTSW	17	24581198	missense	probably benign
X0024:Pkd1	UTSW	17	24591392	missense	possibly damaging	0.68
X0061:Pkd1	UTSW	17	24594931	missense	probably damaging	1.00
X0065:Pkd1	UTSW	17	24586164	missense	probably benign	0.19
Z1088:Pkd1	UTSW	17	24565605	missense	probably benign	0.44
Z1177:Pkd1	UTSW	17	24575491	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGGCTACATCTTCACACTCAC -3'
(R):5'- GTACAACCACAGCTAGGCTC -3'

Sequencing Primer
(F):5'- TCACTGTGCTGGGCCACTC -3'
(R):5'- AGGACAGCCCCATAGGTG -3'

Posted On

2015-04-17