Incidental Mutation 'R3947:Olfr123'
ID307766
Institutional Source Beutler Lab
Gene Symbol Olfr123
Ensembl Gene ENSMUSG00000045202
Gene Nameolfactory receptor 123
SynonymsMOR256-9, GA_x6K02T2PSCP-2255106-2256035
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37793529-37798134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37796115 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 224 (I224L)
Ref Sequence ENSEMBL: ENSMUSP00000149802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054748] [ENSMUST00000214770] [ENSMUST00000215168] [ENSMUST00000216051] [ENSMUST00000216478]
Predicted Effect probably benign
Transcript: ENSMUST00000054748
AA Change: I224L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058678
Gene: ENSMUSG00000045202
AA Change: I224L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 163 2.9e-6 PFAM
Pfam:7tm_4 29 306 2.3e-44 PFAM
Pfam:7TM_GPCR_Srsx 33 144 2.4e-5 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174446
Predicted Effect probably benign
Transcript: ENSMUST00000214770
AA Change: I224L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215168
Predicted Effect probably benign
Transcript: ENSMUST00000216051
AA Change: I224L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216478
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Olfr123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Olfr123 APN 17 37795522 missense probably damaging 0.99
IGL03030:Olfr123 APN 17 37796271 missense probably damaging 1.00
IGL03107:Olfr123 APN 17 37795788 missense probably benign 0.01
R0329:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0330:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0524:Olfr123 UTSW 17 37795605 nonsense probably null
R0581:Olfr123 UTSW 17 37796102 missense probably damaging 1.00
R1288:Olfr123 UTSW 17 37795693 missense probably damaging 0.98
R1897:Olfr123 UTSW 17 37796184 missense probably benign 0.22
R3751:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3753:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3780:Olfr123 UTSW 17 37796004 missense probably damaging 1.00
R5925:Olfr123 UTSW 17 37795591 missense probably benign 0.00
R5987:Olfr123 UTSW 17 37796357 missense probably benign
R6369:Olfr123 UTSW 17 37795496 missense probably benign 0.02
R6891:Olfr123 UTSW 17 37795504 missense probably benign
R7320:Olfr123 UTSW 17 37796357 missense probably benign
R7997:Olfr123 UTSW 17 37796162 nonsense probably null
R8153:Olfr123 UTSW 17 37795476 missense probably benign 0.00
R8793:Olfr123 UTSW 17 37796364 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GGAATCTCATGGCTCAGTGG -3'
(R):5'- TTAAGGGTCGGGGTCATAACAG -3'

Sequencing Primer
(F):5'- CAGTGGAATAGGAAATGCTCTCATCC -3'
(R):5'- TCGGGGTCATAACAGTGTAAAAG -3'
Posted On2015-04-17