Incidental Mutation 'R3947:Grk2'
ID307768
Institutional Source Beutler Lab
Gene Symbol Grk2
Ensembl Gene ENSMUSG00000024858
Gene NameG protein-coupled receptor kinase 2
SynonymsAdrbk-1, beta-adrenergic receptor kinase-1, beta-AR kinase-1, Bark-1, beta ARK, beta ARK1, betaARK1, Adrbk1
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4286001-4306222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4292417 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 129 (T129M)
Ref Sequence ENSEMBL: ENSMUSP00000109468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025791] [ENSMUST00000088737] [ENSMUST00000113837] [ENSMUST00000167511] [ENSMUST00000171123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025791
AA Change: T87M

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025791
Gene: ENSMUSG00000024858
AA Change: T87M

DomainStartEndE-ValueType
RGS 12 133 3.17e-30 SMART
S_TKc 149 411 2.43e-86 SMART
S_TK_X 412 491 5.3e-9 SMART
PH 517 612 2.79e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000088737
AA Change: T129M

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086114
Gene: ENSMUSG00000024858
AA Change: T129M

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
S_TKc 191 453 2.43e-86 SMART
S_TK_X 454 533 5.3e-9 SMART
PH 559 654 2.79e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113837
AA Change: T129M

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109468
Gene: ENSMUSG00000024858
AA Change: T129M

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164427
Predicted Effect probably benign
Transcript: ENSMUST00000165954
SMART Domains Protein: ENSMUSP00000128177
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Pfam:Pkinase 1 169 5.8e-46 PFAM
Pfam:Pkinase_Tyr 2 155 9.3e-20 PFAM
S_TK_X 170 208 3.39e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167172
Predicted Effect probably benign
Transcript: ENSMUST00000167511
SMART Domains Protein: ENSMUSP00000129839
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Pfam:RGS 74 134 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168594
SMART Domains Protein: ENSMUSP00000126025
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Blast:S_TKc 2 38 2e-18 BLAST
S_TK_X 39 85 2.95e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169991
Predicted Effect possibly damaging
Transcript: ENSMUST00000171123
AA Change: T129M

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126930
Gene: ENSMUSG00000024858
AA Change: T129M

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Pfam:Pkinase_Tyr 191 378 1.1e-21 PFAM
Pfam:Pkinase 191 381 4.9e-50 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene phosphorylates the beta-2-adrenergic receptor and appears to mediate agonist-specific desensitization observed at high agonist concentrations. This protein is an ubiquitous cytosolic enzyme that specifically phosphorylates the activated form of the beta-adrenergic and related G-protein-coupled receptors. Abnormal coupling of beta-adrenergic receptor to G protein is involved in the pathogenesis of the failing heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality likely due to heart failure. Homozygous mutant embryos are pale in appearance and exhibit ventricular hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Grk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Grk2 APN 19 4289311 critical splice donor site probably null
IGL00927:Grk2 APN 19 4287954 missense probably benign 0.09
IGL01465:Grk2 APN 19 4290858 missense probably damaging 1.00
IGL02692:Grk2 APN 19 4290688 splice site probably benign
IGL02870:Grk2 APN 19 4290402 missense probably damaging 1.00
IGL03210:Grk2 APN 19 4287829 missense probably benign 0.01
IGL03227:Grk2 APN 19 4287829 missense probably benign 0.01
IGL03230:Grk2 APN 19 4287829 missense probably benign 0.01
Greco UTSW 19 4290602 critical splice donor site probably null
PIT4480001:Grk2 UTSW 19 4287409 missense possibly damaging 0.93
R0008:Grk2 UTSW 19 4287234 missense probably damaging 0.99
R0371:Grk2 UTSW 19 4291586 splice site probably null
R0426:Grk2 UTSW 19 4290600 splice site probably null
R0494:Grk2 UTSW 19 4291319 missense probably damaging 1.00
R0833:Grk2 UTSW 19 4289357 missense probably damaging 1.00
R1240:Grk2 UTSW 19 4290679 missense probably damaging 1.00
R1446:Grk2 UTSW 19 4287409 missense possibly damaging 0.93
R1499:Grk2 UTSW 19 4287194 missense probably benign 0.11
R1664:Grk2 UTSW 19 4287240 missense possibly damaging 0.48
R1796:Grk2 UTSW 19 4287940 missense probably benign 0.12
R1803:Grk2 UTSW 19 4294883 missense probably damaging 1.00
R2021:Grk2 UTSW 19 4290670 missense probably damaging 1.00
R4551:Grk2 UTSW 19 4286056 missense possibly damaging 0.96
R4945:Grk2 UTSW 19 4290447 missense probably damaging 1.00
R5299:Grk2 UTSW 19 4292771 missense probably damaging 1.00
R5753:Grk2 UTSW 19 4290468 missense probably damaging 1.00
R5754:Grk2 UTSW 19 4290468 missense probably damaging 1.00
R5973:Grk2 UTSW 19 4287897 missense possibly damaging 0.88
R6026:Grk2 UTSW 19 4290783 missense probably damaging 0.99
R7117:Grk2 UTSW 19 4290602 critical splice donor site probably null
R7468:Grk2 UTSW 19 4306035 start gained probably benign
R7764:Grk2 UTSW 19 4287363 missense probably damaging 1.00
R8789:Grk2 UTSW 19 4288483 missense probably damaging 1.00
X0009:Grk2 UTSW 19 4291589 critical splice donor site probably null
Z1176:Grk2 UTSW 19 4287645 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGAGGTTCTGACAAATCTCCTC -3'
(R):5'- GCAGCCGAGAGATCTTTGAC -3'

Sequencing Primer
(F):5'- CAAATCTCCTCAATGTATGGCTGTGG -3'
(R):5'- CTCCTATATTATGAAAGAACTGCTGG -3'
Posted On2015-04-17