Mutagenetix > Incidental Mutation

Incidental Mutation 'R3947:Cfap43'

307769

Institutional Source

Beutler Lab

Gene Symbol

Cfap43

Ensembl Gene

ENSMUSG00000044948

Gene Name

cilia and flagella associated protein 43

Synonyms

4930463G05Rik, D19Ertd652e, 4632415N18Rik, 4930428C11Rik, Wdr96

MMRRC Submission

040927-MU

Accession Numbers

Genbank: NM_027559

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R3947 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47737561-47919299 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 47765979 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 969 (H969N)

Ref Sequence

ENSEMBL: ENSMUSP00000125007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160247]

AlphaFold

E9Q7R9

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159999

Predicted Effect

probably benign
Transcript: ENSMUST00000160247
AA Change: H969N

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948
AA Change: H969N

Domain	Start	End	E-Value	Type
low complexity region	12	36	N/A	INTRINSIC
Blast:WD40	70	111	6e-7	BLAST
Blast:WD40	115	156	1e-5	BLAST
Blast:WD40	162	197	8e-10	BLAST
WD40	349	388	1.07e0	SMART
Blast:WD40	392	432	3e-13	BLAST
WD40	435	473	3.96e1	SMART
WD40	479	518	3.82e1	SMART
Blast:WD40	638	683	8e-17	BLAST
Blast:WD40	689	728	1e-17	BLAST
low complexity region	766	781	N/A	INTRINSIC
coiled coil region	855	886	N/A	INTRINSIC
coiled coil region	925	961	N/A	INTRINSIC
low complexity region	971	981	N/A	INTRINSIC
coiled coil region	1170	1224	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
low complexity region	1268	1279	N/A	INTRINSIC
low complexity region	1524	1529	N/A	INTRINSIC
coiled coil region	1652	1671	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161832

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162657

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (32/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	A	14: 54,679,333	Q133L	possibly damaging	Het
Adgrg4	C	T	X: 56,917,754	T1561I	probably benign	Het
Avl9	T	C	6: 56,728,665		probably null	Het
C87436	T	A	6: 86,446,186	H247Q	probably damaging	Het
Chst15	T	A	7: 132,247,875	N446Y	probably damaging	Het
Col4a3	T	A	1: 82,715,332	I1446N	probably damaging	Het
Disc1	A	G	8: 125,088,135	E246G	probably damaging	Het
Dyrk4	A	G	6: 126,885,305	I408T	probably damaging	Het
Fnbp1l	G	T	3: 122,544,579	A481D	possibly damaging	Het
Gm10608	TACACACACACACACACACACACACACACACACACACACACACACACACACACACA	TACACACACACACACACACACACACACACACACACACACACACACACACA	9: 119,160,662		probably benign	Het
Grk2	G	A	19: 4,292,417	T129M	possibly damaging	Het
Ino80d	G	T	1: 63,074,503	Q263K	probably benign	Het
Iqsec3	A	T	6: 121,387,824	Y835*	probably null	Het
Irak3	T	A	10: 120,170,373	M213L	probably benign	Het
Macf1	T	C	4: 123,380,420	R6388G	probably damaging	Het
Mtnr1a	T	C	8: 45,087,520	Y173H	probably damaging	Het
Myo5b	C	T	18: 74,695,403	R709W	probably damaging	Het
Nebl	A	T	2: 17,378,106		probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr123	A	T	17: 37,796,115	I224L	probably benign	Het
Pex11g	G	A	8: 3,465,787	T82I	probably benign	Het
Pgr	A	G	9: 8,961,452	I842V	probably benign	Het
Pkd1	T	A	17: 24,578,037		probably benign	Het
Rbm20	T	C	19: 53,813,337	I92T	probably benign	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Ssh2	A	G	11: 77,398,256	D88G	probably damaging	Het
Suclg2	G	T	6: 95,579,238		probably null	Het
Tdrd3	A	T	14: 87,506,599	D655V	probably damaging	Het
Tex2	C	T	11: 106,520,003	D896N	unknown	Het
Tmem168	C	A	6: 13,583,052	R610L	probably damaging	Het
Ttc17	A	G	2: 94,376,146		probably benign	Het
Vmn2r99	T	C	17: 19,378,990	M312T	probably benign	Het
Wdfy3	T	C	5: 101,870,036	E2546G	probably damaging	Het

Other mutations in Cfap43

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Cfap43	APN	19	47830475	missense	probably benign	0.08
IGL00325:Cfap43	APN	19	47823188	splice site	probably benign
IGL00918:Cfap43	APN	19	47896661	missense	probably damaging	1.00
IGL01402:Cfap43	APN	19	47795666	missense	probably benign	0.25
IGL01404:Cfap43	APN	19	47795666	missense	probably benign	0.25
IGL01656:Cfap43	APN	19	47751900	missense	possibly damaging	0.95
IGL01738:Cfap43	APN	19	47797185	missense	probably damaging	0.97
IGL02168:Cfap43	APN	19	47751923	splice site	probably benign
IGL02225:Cfap43	APN	19	47812177	missense	probably benign	0.00
IGL02308:Cfap43	APN	19	47748024	missense	probably benign
IGL02354:Cfap43	APN	19	47897413	nonsense	probably null
IGL02361:Cfap43	APN	19	47897413	nonsense	probably null
IGL03283:Cfap43	APN	19	47791412	splice site	probably benign
3-1:Cfap43	UTSW	19	47751855	missense	probably benign	0.02
IGL03046:Cfap43	UTSW	19	47815863	missense	probably damaging	1.00
PIT4495001:Cfap43	UTSW	19	47897302	missense	probably damaging	1.00
R0270:Cfap43	UTSW	19	47797203	splice site	probably benign
R0421:Cfap43	UTSW	19	47835575	missense	probably benign	0.00
R0433:Cfap43	UTSW	19	47825771	missense	probably benign	0.44
R0576:Cfap43	UTSW	19	47797140	missense	probably benign	0.00
R0646:Cfap43	UTSW	19	47763676	missense	probably benign	0.25
R0740:Cfap43	UTSW	19	47835804	missense	possibly damaging	0.95
R0836:Cfap43	UTSW	19	47815846	missense	probably benign	0.02
R0899:Cfap43	UTSW	19	47747994	missense	possibly damaging	0.93
R1171:Cfap43	UTSW	19	47835711	missense	probably benign	0.03
R1271:Cfap43	UTSW	19	47739744	missense	probably benign	0.22
R1271:Cfap43	UTSW	19	47747948	missense	probably damaging	0.98
R1371:Cfap43	UTSW	19	47835606	missense	possibly damaging	0.95
R1469:Cfap43	UTSW	19	47896875	missense	probably damaging	1.00
R1541:Cfap43	UTSW	19	47763852	splice site	probably null
R1625:Cfap43	UTSW	19	47751088	missense	probably damaging	1.00
R1679:Cfap43	UTSW	19	47773114	missense	probably benign	0.00
R1690:Cfap43	UTSW	19	47751066	critical splice donor site	probably null
R1820:Cfap43	UTSW	19	47897216	missense	probably damaging	0.99
R1891:Cfap43	UTSW	19	47813941	missense	probably damaging	0.97
R1956:Cfap43	UTSW	19	47897210	missense	probably benign	0.19
R1958:Cfap43	UTSW	19	47897210	missense	probably benign	0.19
R2110:Cfap43	UTSW	19	47835758	missense	probably damaging	1.00
R2118:Cfap43	UTSW	19	47770438	missense	probably damaging	1.00
R2290:Cfap43	UTSW	19	47773135	missense	probably damaging	0.99
R3691:Cfap43	UTSW	19	47897073	missense	probably benign	0.01
R3765:Cfap43	UTSW	19	47835575	missense	probably benign	0.01
R3917:Cfap43	UTSW	19	47897750	missense	probably benign	0.00
R3924:Cfap43	UTSW	19	47797116	missense	probably benign	0.00
R3925:Cfap43	UTSW	19	47797116	missense	probably benign	0.00
R4256:Cfap43	UTSW	19	47782405	missense	probably benign	0.06
R4385:Cfap43	UTSW	19	47797129	missense	probably benign	0.28
R4395:Cfap43	UTSW	19	47751913	missense	probably benign	0.00
R4405:Cfap43	UTSW	19	47739797	missense	possibly damaging	0.57
R4541:Cfap43	UTSW	19	47748015	missense	probably benign	0.02
R4583:Cfap43	UTSW	19	47837216	missense	probably null	0.99
R4690:Cfap43	UTSW	19	47747859	missense	probably benign	0.45
R4852:Cfap43	UTSW	19	47897111	missense	possibly damaging	0.87
R5185:Cfap43	UTSW	19	47780394	missense	probably benign	0.00
R5192:Cfap43	UTSW	19	47825925	missense	probably damaging	1.00
R5196:Cfap43	UTSW	19	47825925	missense	probably damaging	1.00
R5197:Cfap43	UTSW	19	47897372	missense	probably damaging	1.00
R5205:Cfap43	UTSW	19	47897548	missense	possibly damaging	0.76
R5425:Cfap43	UTSW	19	47896932	missense	possibly damaging	0.94
R5516:Cfap43	UTSW	19	47738209	splice site	probably null
R5644:Cfap43	UTSW	19	47795675	missense	possibly damaging	0.66
R5844:Cfap43	UTSW	19	47795696	missense	probably benign
R5901:Cfap43	UTSW	19	47897099	missense	probably damaging	0.97
R5910:Cfap43	UTSW	19	47780271	missense	possibly damaging	0.63
R5920:Cfap43	UTSW	19	47760896	missense	possibly damaging	0.88
R5963:Cfap43	UTSW	19	47745574	missense	probably benign	0.42
R6817:Cfap43	UTSW	19	47756085	missense	possibly damaging	0.88
R6974:Cfap43	UTSW	19	47785278	critical splice donor site	probably null
R7219:Cfap43	UTSW	19	47791473	missense	probably benign	0.02
R7270:Cfap43	UTSW	19	47739785	missense	possibly damaging	0.86
R7733:Cfap43	UTSW	19	47897993	missense	possibly damaging	0.75
R7995:Cfap43	UTSW	19	47898023	missense	probably damaging	1.00
R8013:Cfap43	UTSW	19	47773109	missense	probably damaging	0.99
R8176:Cfap43	UTSW	19	47795675	missense	probably benign	0.00
R8242:Cfap43	UTSW	19	47897369	missense	probably damaging	1.00
R8303:Cfap43	UTSW	19	47765835	nonsense	probably null
R8333:Cfap43	UTSW	19	47897326	nonsense	probably null
R8353:Cfap43	UTSW	19	47746647	missense	probably damaging	1.00
R8453:Cfap43	UTSW	19	47746647	missense	probably damaging	1.00
R8474:Cfap43	UTSW	19	47897924	missense	probably benign	0.32
R8478:Cfap43	UTSW	19	47776076	missense	probably benign	0.02
R8676:Cfap43	UTSW	19	47748017	missense	possibly damaging	0.95
R8928:Cfap43	UTSW	19	47815960	missense	probably benign	0.00
R9190:Cfap43	UTSW	19	47737854	missense	possibly damaging	0.65
R9426:Cfap43	UTSW	19	47825798	missense	probably damaging	0.99
R9450:Cfap43	UTSW	19	47897871	missense	probably benign	0.23
R9491:Cfap43	UTSW	19	47812066	critical splice donor site	probably null
R9515:Cfap43	UTSW	19	47785375	missense	probably damaging	1.00
R9732:Cfap43	UTSW	19	47787007	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCCTGTGTGTAATGTCATAGTAATG -3'
(R):5'- CTGCAGCCATTTCAGCATCC -3'

Sequencing Primer
(F):5'- AAGGAAATTCACTCACCTTTAGC -3'
(R):5'- TGAACCGAACTTCTGGCAAG -3'

Posted On

2015-04-17