Incidental Mutation 'R3947:Adgrg4'
ID307771
Institutional Source Beutler Lab
Gene Symbol Adgrg4
Ensembl Gene ENSMUSG00000053852
Gene Nameadhesion G protein-coupled receptor G4
SynonymsGpr112, LOC236798, PGR17
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3947 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location56870163-57001558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56917754 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1561 (T1561I)
Ref Sequence ENSEMBL: ENSMUSP00000119486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136396] [ENSMUST00000153784] [ENSMUST00000154818] [ENSMUST00000168724]
Predicted Effect probably benign
Transcript: ENSMUST00000136396
AA Change: T1703I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000116655
Gene: ENSMUSG00000053852
AA Change: T1703I

DomainStartEndE-ValueType
SCOP:d1saca_ 2 159 5e-14 SMART
low complexity region 242 261 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
internal_repeat_1 459 720 5.68e-5 PROSPERO
internal_repeat_1 719 999 5.68e-5 PROSPERO
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1079 1101 N/A INTRINSIC
low complexity region 1243 1261 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1536 1550 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1843 1864 N/A INTRINSIC
low complexity region 1892 1911 N/A INTRINSIC
low complexity region 1953 1970 N/A INTRINSIC
low complexity region 2068 2076 N/A INTRINSIC
low complexity region 2257 2269 N/A INTRINSIC
GPS 2384 2436 1.79e-18 SMART
Pfam:7tm_2 2443 2684 4.8e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153784
AA Change: T1766I

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116634
Gene: ENSMUSG00000053852
AA Change: T1766I

DomainStartEndE-ValueType
SCOP:d1saca_ 28 222 1e-17 SMART
low complexity region 305 324 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
internal_repeat_1 522 783 2.5e-5 PROSPERO
internal_repeat_1 782 1062 2.5e-5 PROSPERO
low complexity region 1076 1087 N/A INTRINSIC
low complexity region 1114 1129 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1306 1324 N/A INTRINSIC
low complexity region 1409 1420 N/A INTRINSIC
low complexity region 1599 1613 N/A INTRINSIC
low complexity region 1643 1659 N/A INTRINSIC
low complexity region 1906 1927 N/A INTRINSIC
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 2016 2033 N/A INTRINSIC
low complexity region 2131 2139 N/A INTRINSIC
low complexity region 2289 2300 N/A INTRINSIC
low complexity region 2459 2471 N/A INTRINSIC
GPS 2631 2683 1.79e-18 SMART
Pfam:7tm_2 2691 2932 8.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154818
AA Change: T1561I

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119486
Gene: ENSMUSG00000053852
AA Change: T1561I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 100 119 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
internal_repeat_1 317 578 4.23e-5 PROSPERO
internal_repeat_1 577 857 4.23e-5 PROSPERO
low complexity region 871 882 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 937 959 N/A INTRINSIC
low complexity region 1101 1119 N/A INTRINSIC
low complexity region 1204 1215 N/A INTRINSIC
low complexity region 1394 1408 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1701 1722 N/A INTRINSIC
low complexity region 1750 1769 N/A INTRINSIC
low complexity region 1811 1828 N/A INTRINSIC
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 2084 2095 N/A INTRINSIC
low complexity region 2254 2266 N/A INTRINSIC
GPS 2426 2478 1.79e-18 SMART
Pfam:7tm_2 2485 2727 3.9e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168724
SMART Domains Protein: ENSMUSP00000127627
Gene: ENSMUSG00000053852

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Meta Mutation Damage Score 0.1073 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor belonging to a large family of diverse integral membrane proteins that participate in various physiological functions. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The ligand for this family member is unknown, and it is therefore an orphan receptor. This receptor is known to be expressed in normal enterochromaffin cells and in gastrointestinal neuroendocrine carcinoma cells, and it is therefore considered to be a novel biomarker or target for immunotherapy. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T A 14: 54,679,333 Q133L possibly damaging Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Adgrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Adgrg4 APN X 56977596 missense probably damaging 1.00
R3407:Adgrg4 UTSW X 56968127 missense probably damaging 0.97
R3408:Adgrg4 UTSW X 56968127 missense probably damaging 0.97
R3948:Adgrg4 UTSW X 56917754 missense probably benign 0.25
R4067:Adgrg4 UTSW X 56959960 missense probably damaging 1.00
R4207:Adgrg4 UTSW X 56918749 missense possibly damaging 0.92
R4393:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4395:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4397:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4504:Adgrg4 UTSW X 56916442 missense possibly damaging 0.63
Z1176:Adgrg4 UTSW X 56894702 missense probably benign 0.00
Z1176:Adgrg4 UTSW X 56914259 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCCCACTCTGGACATATTAC -3'
(R):5'- TCAGCCATTTGAGATGCAAGTG -3'

Sequencing Primer
(F):5'- CTGGACATATTACCTGGGATCACTG -3'
(R):5'- CAAGTGGAAACTTGGCCTTGGTAC -3'
Posted On2015-04-17