Mutagenetix > Incidental Mutation

Incidental Mutation 'R3947:Adgrg4'

307771

Institutional Source

Beutler Lab

Gene Symbol

Adgrg4

Ensembl Gene

ENSMUSG00000053852

Gene Name

adhesion G protein-coupled receptor G4

Synonyms

Gpr112, PGR17, LOC236798

MMRRC Submission

040927-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R3947 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

55939594-56025719 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 55963114 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1561 (T1561I)

Ref Sequence

ENSEMBL: ENSMUSP00000119486 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000136396] [ENSMUST00000153784] [ENSMUST00000154818] [ENSMUST00000168724]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000136396
AA Change: T1703I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000116655
Gene: ENSMUSG00000053852
AA Change: T1703I

Domain	Start	End	E-Value	Type
SCOP:d1saca_	2	159	5e-14	SMART
low complexity region	242	261	N/A	INTRINSIC
low complexity region	310	321	N/A	INTRINSIC
internal_repeat_1	459	720	5.68e-5	PROSPERO
internal_repeat_1	719	999	5.68e-5	PROSPERO
low complexity region	1013	1024	N/A	INTRINSIC
low complexity region	1051	1066	N/A	INTRINSIC
low complexity region	1079	1101	N/A	INTRINSIC
low complexity region	1243	1261	N/A	INTRINSIC
low complexity region	1346	1357	N/A	INTRINSIC
low complexity region	1536	1550	N/A	INTRINSIC
low complexity region	1580	1596	N/A	INTRINSIC
low complexity region	1843	1864	N/A	INTRINSIC
low complexity region	1892	1911	N/A	INTRINSIC
low complexity region	1953	1970	N/A	INTRINSIC
low complexity region	2068	2076	N/A	INTRINSIC
low complexity region	2257	2269	N/A	INTRINSIC
GPS	2384	2436	1.79e-18	SMART
Pfam:7tm_2	2443	2684	4.8e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153784
AA Change: T1766I

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000116634
Gene: ENSMUSG00000053852
AA Change: T1766I

Domain	Start	End	E-Value	Type
SCOP:d1saca_	28	222	1e-17	SMART
low complexity region	305	324	N/A	INTRINSIC
low complexity region	373	384	N/A	INTRINSIC
internal_repeat_1	522	783	2.5e-5	PROSPERO
internal_repeat_1	782	1062	2.5e-5	PROSPERO
low complexity region	1076	1087	N/A	INTRINSIC
low complexity region	1114	1129	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1306	1324	N/A	INTRINSIC
low complexity region	1409	1420	N/A	INTRINSIC
low complexity region	1599	1613	N/A	INTRINSIC
low complexity region	1643	1659	N/A	INTRINSIC
low complexity region	1906	1927	N/A	INTRINSIC
low complexity region	1955	1974	N/A	INTRINSIC
low complexity region	2016	2033	N/A	INTRINSIC
low complexity region	2131	2139	N/A	INTRINSIC
low complexity region	2289	2300	N/A	INTRINSIC
low complexity region	2459	2471	N/A	INTRINSIC
GPS	2631	2683	1.79e-18	SMART
Pfam:7tm_2	2691	2932	8.6e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000154818
AA Change: T1561I

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000119486
Gene: ENSMUSG00000053852
AA Change: T1561I

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	100	119	N/A	INTRINSIC
low complexity region	168	179	N/A	INTRINSIC
internal_repeat_1	317	578	4.23e-5	PROSPERO
internal_repeat_1	577	857	4.23e-5	PROSPERO
low complexity region	871	882	N/A	INTRINSIC
low complexity region	909	924	N/A	INTRINSIC
low complexity region	937	959	N/A	INTRINSIC
low complexity region	1101	1119	N/A	INTRINSIC
low complexity region	1204	1215	N/A	INTRINSIC
low complexity region	1394	1408	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1701	1722	N/A	INTRINSIC
low complexity region	1750	1769	N/A	INTRINSIC
low complexity region	1811	1828	N/A	INTRINSIC
low complexity region	1926	1934	N/A	INTRINSIC
low complexity region	2084	2095	N/A	INTRINSIC
low complexity region	2254	2266	N/A	INTRINSIC
GPS	2426	2478	1.79e-18	SMART
Pfam:7tm_2	2485	2727	3.9e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168724

SMART Domains

Protein: ENSMUSP00000127627
Gene: ENSMUSG00000053852

Domain	Start	End	E-Value	Type
low complexity region	52	63	N/A	INTRINSIC

Meta Mutation Damage Score

0.1073

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (32/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor belonging to a large family of diverse integral membrane proteins that participate in various physiological functions. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The ligand for this family member is unknown, and it is therefore an orphan receptor. This receptor is known to be expressed in normal enterochromaffin cells and in gastrointestinal neuroendocrine carcinoma cells, and it is therefore considered to be a novel biomarker or target for immunotherapy. [provided by RefSeq, May 2010]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	A	14: 54,916,790 (GRCm39)	Q133L	possibly damaging	Het
Avl9	T	C	6: 56,705,650 (GRCm39)		probably null	Het
C87436	T	A	6: 86,423,168 (GRCm39)	H247Q	probably damaging	Het
Cfap43	G	T	19: 47,754,418 (GRCm39)	H969N	probably benign	Het
Chst15	T	A	7: 131,849,604 (GRCm39)	N446Y	probably damaging	Het
Col4a3	T	A	1: 82,693,053 (GRCm39)	I1446N	probably damaging	Het
Disc1	A	G	8: 125,814,874 (GRCm39)	E246G	probably damaging	Het
Dyrk4	A	G	6: 126,862,268 (GRCm39)	I408T	probably damaging	Het
Fnbp1l	G	T	3: 122,338,228 (GRCm39)	A481D	possibly damaging	Het
Gm10608	TACACACACACACACACACACACACACACACACACACACACACACACACACACACA	TACACACACACACACACACACACACACACACACACACACACACACACACA	9: 118,989,730 (GRCm39)		probably benign	Het
Grk2	G	A	19: 4,342,445 (GRCm39)	T129M	possibly damaging	Het
Ino80d	G	T	1: 63,113,662 (GRCm39)	Q263K	probably benign	Het
Iqsec3	A	T	6: 121,364,783 (GRCm39)	Y835*	probably null	Het
Irak3	T	A	10: 120,006,278 (GRCm39)	M213L	probably benign	Het
Macf1	T	C	4: 123,274,213 (GRCm39)	R6388G	probably damaging	Het
Mtnr1a	T	C	8: 45,540,557 (GRCm39)	Y173H	probably damaging	Het
Myo5b	C	T	18: 74,828,474 (GRCm39)	R709W	probably damaging	Het
Nebl	A	T	2: 17,382,917 (GRCm39)		probably null	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or2g1	A	T	17: 38,107,006 (GRCm39)	I224L	probably benign	Het
Pex11g	G	A	8: 3,515,787 (GRCm39)	T82I	probably benign	Het
Pgr	A	G	9: 8,961,453 (GRCm39)	I842V	probably benign	Het
Pkd1	T	A	17: 24,797,011 (GRCm39)		probably benign	Het
Rbm20	T	C	19: 53,801,768 (GRCm39)	I92T	probably benign	Het
Ryr3	C	G	2: 112,506,218 (GRCm39)	R3443P	probably damaging	Het
Ssh2	A	G	11: 77,289,082 (GRCm39)	D88G	probably damaging	Het
Suclg2	G	T	6: 95,556,219 (GRCm39)		probably null	Het
Tdrd3	A	T	14: 87,744,035 (GRCm39)	D655V	probably damaging	Het
Tex2	C	T	11: 106,410,829 (GRCm39)	D896N	unknown	Het
Tmem168	C	A	6: 13,583,051 (GRCm39)	R610L	probably damaging	Het
Ttc17	A	G	2: 94,206,491 (GRCm39)		probably benign	Het
Vmn2r99	T	C	17: 19,599,252 (GRCm39)	M312T	probably benign	Het
Wdfy3	T	C	5: 102,017,902 (GRCm39)	E2546G	probably damaging	Het

Other mutations in Adgrg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03215:Adgrg4	APN	X	56,022,956 (GRCm39)	missense	probably damaging	1.00
R3407:Adgrg4	UTSW	X	56,013,487 (GRCm39)	missense	probably damaging	0.97
R3408:Adgrg4	UTSW	X	56,013,487 (GRCm39)	missense	probably damaging	0.97
R3948:Adgrg4	UTSW	X	55,963,114 (GRCm39)	missense	probably benign	0.25
R4067:Adgrg4	UTSW	X	56,005,320 (GRCm39)	missense	probably damaging	1.00
R4207:Adgrg4	UTSW	X	55,964,109 (GRCm39)	missense	possibly damaging	0.92
R4393:Adgrg4	UTSW	X	55,977,703 (GRCm39)	missense	probably damaging	1.00
R4395:Adgrg4	UTSW	X	55,977,703 (GRCm39)	missense	probably damaging	1.00
R4397:Adgrg4	UTSW	X	55,977,703 (GRCm39)	missense	probably damaging	1.00
R4504:Adgrg4	UTSW	X	55,961,802 (GRCm39)	missense	possibly damaging	0.63
Z1176:Adgrg4	UTSW	X	55,959,619 (GRCm39)	missense	probably benign	0.00
Z1176:Adgrg4	UTSW	X	55,940,062 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCTCCCACTCTGGACATATTAC -3'
(R):5'- TCAGCCATTTGAGATGCAAGTG -3'

Sequencing Primer
(F):5'- CTGGACATATTACCTGGGATCACTG -3'
(R):5'- CAAGTGGAAACTTGGCCTTGGTAC -3'

Posted On

2015-04-17