Incidental Mutation 'R3948:Ankrd50'
ID307777
Institutional Source Beutler Lab
Gene Symbol Ankrd50
Ensembl Gene ENSMUSG00000044864
Gene Nameankyrin repeat domain 50
SynonymsE430012K20Rik
MMRRC Submission 040928-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R3948 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location38449259-38484844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38482841 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 121 (L121S)
Ref Sequence ENSEMBL: ENSMUSP00000113349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120875] [ENSMUST00000156038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120875
AA Change: L121S

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113349
Gene: ENSMUSG00000044864
AA Change: L121S

DomainStartEndE-ValueType
SCOP:d1kaga_ 72 90 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127837
Predicted Effect probably benign
Transcript: ENSMUST00000156038
AA Change: L84S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122842
Gene: ENSMUSG00000044864
AA Change: L84S

DomainStartEndE-ValueType
Blast:ANK 440 472 8e-11 BLAST
ANK 507 536 7.95e-4 SMART
ANK 540 569 1.01e-5 SMART
ANK 573 602 6.81e-3 SMART
ANK 606 635 1.7e-3 SMART
ANK 639 668 7.64e-6 SMART
ANK 672 706 4.5e-3 SMART
ANK 710 739 3.33e-6 SMART
ANK 743 772 5.37e-1 SMART
ANK 776 806 1.65e-1 SMART
ANK 809 838 1.2e-3 SMART
ANK 842 871 3.97e-4 SMART
ANK 875 904 3.06e-5 SMART
ANK 908 937 2.88e-1 SMART
ANK 941 970 1.16e-5 SMART
ANK 974 1003 3.41e-3 SMART
ANK 1007 1036 2.9e-6 SMART
ANK 1040 1070 3.31e-1 SMART
low complexity region 1139 1166 N/A INTRINSIC
low complexity region 1185 1205 N/A INTRINSIC
low complexity region 1224 1255 N/A INTRINSIC
Meta Mutation Damage Score 0.3203 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,477 L368P possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Avil A G 10: 127,014,205 S642G probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
BC003331 A T 1: 150,388,557 L67* probably null Het
Dhx15 T C 5: 52,161,580 probably benign Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fbxo38 A G 18: 62,529,544 probably benign Het
Gm13128 A C 4: 144,331,306 Q161P probably benign Het
H2-T24 T C 17: 36,017,372 Y73C probably damaging Het
Hal T C 10: 93,489,907 I94T possibly damaging Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Kcnj2 A G 11: 111,072,655 D291G possibly damaging Het
Krtap13 A G 16: 88,751,069 L177P possibly damaging Het
Mios A G 6: 8,215,496 T231A probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1228 A G 2: 89,248,992 F234S possibly damaging Het
Ralgapa1 C A 12: 55,698,767 V1268F probably damaging Het
Rev1 A T 1: 38,074,333 M551K possibly damaging Het
Serpinb9c A C 13: 33,150,094 C322G probably benign Het
Slc28a3 C T 13: 58,563,010 probably null Het
Slc35e4 A T 11: 3,912,970 V73E probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Trim5 G A 7: 104,266,520 Q273* probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vps13d G A 4: 145,141,340 T1974M probably damaging Het
Wdr25 T A 12: 109,027,282 C475S probably benign Het
Zfp202 C A 9: 40,208,425 H175N probably benign Het
Zfp248 TTAAATTCAT TT 6: 118,430,194 probably null Het
Other mutations in Ankrd50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ankrd50 APN 3 38452414 utr 3 prime probably benign
PIT4378001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4434001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4651001:Ankrd50 UTSW 3 38455810 nonsense probably null
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0127:Ankrd50 UTSW 3 38456235 missense probably benign 0.00
R0179:Ankrd50 UTSW 3 38455314 missense possibly damaging 0.61
R0417:Ankrd50 UTSW 3 38456361 missense probably damaging 1.00
R0593:Ankrd50 UTSW 3 38483007 nonsense probably null
R1076:Ankrd50 UTSW 3 38454922 missense probably damaging 0.97
R1127:Ankrd50 UTSW 3 38457187 missense probably benign 0.02
R1169:Ankrd50 UTSW 3 38454252 missense probably damaging 1.00
R1212:Ankrd50 UTSW 3 38455687 missense probably damaging 1.00
R1447:Ankrd50 UTSW 3 38455542 missense probably damaging 1.00
R1864:Ankrd50 UTSW 3 38454461 missense probably benign 0.02
R1900:Ankrd50 UTSW 3 38455387 missense probably damaging 1.00
R1907:Ankrd50 UTSW 3 38454052 missense probably damaging 1.00
R1912:Ankrd50 UTSW 3 38456776 missense probably benign 0.07
R2051:Ankrd50 UTSW 3 38454493 missense probably benign 0.21
R2197:Ankrd50 UTSW 3 38455592 missense probably damaging 1.00
R2403:Ankrd50 UTSW 3 38483085 nonsense probably null
R3716:Ankrd50 UTSW 3 38454150 missense probably damaging 0.99
R3944:Ankrd50 UTSW 3 38452496 missense probably benign 0.03
R4483:Ankrd50 UTSW 3 38457531 missense probably damaging 1.00
R4577:Ankrd50 UTSW 3 38455941 missense probably damaging 0.98
R4691:Ankrd50 UTSW 3 38483010 missense probably benign 0.01
R4907:Ankrd50 UTSW 3 38454973 nonsense probably null
R4907:Ankrd50 UTSW 3 38456675 missense probably damaging 0.98
R5135:Ankrd50 UTSW 3 38455803 missense probably damaging 1.00
R5356:Ankrd50 UTSW 3 38456185 missense probably damaging 0.99
R5368:Ankrd50 UTSW 3 38455050 missense probably damaging 1.00
R5534:Ankrd50 UTSW 3 38456082 missense probably damaging 0.99
R6103:Ankrd50 UTSW 3 38454429 missense probably damaging 0.99
R6169:Ankrd50 UTSW 3 38455839 missense probably damaging 1.00
R6653:Ankrd50 UTSW 3 38457361 missense probably damaging 1.00
R7317:Ankrd50 UTSW 3 38483183 missense possibly damaging 0.90
R7469:Ankrd50 UTSW 3 38454193 missense probably damaging 0.99
R7617:Ankrd50 UTSW 3 38484682 unclassified probably benign
R7749:Ankrd50 UTSW 3 38482721 missense probably damaging 1.00
Z1088:Ankrd50 UTSW 3 38457165 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGGTGTCTCAGACTTGGATGG -3'
(R):5'- ACGCTGGGAATAATGCTAGTG -3'

Sequencing Primer
(F):5'- AATGCAAGCATGGCTACCTTC -3'
(R):5'- CTGGGAATAATGCTAGTGCCATCTC -3'
Posted On2015-04-17