Incidental Mutation 'R3948:Trim5'
ID307787
Institutional Source Beutler Lab
Gene Symbol Trim5
Ensembl Gene ENSMUSG00000060441
Gene Nametripartite motif-containing 5
Synonyms
MMRRC Submission 040928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3948 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104263386-104288094 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 104266520 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 273 (Q273*)
Ref Sequence ENSEMBL: ENSMUSP00000095781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051795] [ENSMUST00000060315] [ENSMUST00000098179] [ENSMUST00000106848] [ENSMUST00000106849]
Predicted Effect probably null
Transcript: ENSMUST00000051795
AA Change: Q273*
SMART Domains Protein: ENSMUSP00000050084
Gene: ENSMUSG00000060441
AA Change: Q273*

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 172 232 N/A INTRINSIC
Pfam:SPRY 349 485 9.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060315
SMART Domains Protein: ENSMUSP00000055058
Gene: ENSMUSG00000056144

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 347 474 1e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098179
AA Change: Q273*
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441
AA Change: Q273*

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106848
SMART Domains Protein: ENSMUSP00000102461
Gene: ENSMUSG00000056144

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106849
SMART Domains Protein: ENSMUSP00000102462
Gene: ENSMUSG00000056144

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138557
AA Change: T265I

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119127
Gene: ENSMUSG00000060441
AA Change: T265I

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 173 232 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217156
Meta Mutation Damage Score 0.9638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,477 L368P possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Ankrd50 A G 3: 38,482,841 L121S possibly damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Avil A G 10: 127,014,205 S642G probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
BC003331 A T 1: 150,388,557 L67* probably null Het
Dhx15 T C 5: 52,161,580 probably benign Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fbxo38 A G 18: 62,529,544 probably benign Het
Gm13128 A C 4: 144,331,306 Q161P probably benign Het
H2-T24 T C 17: 36,017,372 Y73C probably damaging Het
Hal T C 10: 93,489,907 I94T possibly damaging Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Kcnj2 A G 11: 111,072,655 D291G possibly damaging Het
Krtap13 A G 16: 88,751,069 L177P possibly damaging Het
Mios A G 6: 8,215,496 T231A probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1228 A G 2: 89,248,992 F234S possibly damaging Het
Ralgapa1 C A 12: 55,698,767 V1268F probably damaging Het
Rev1 A T 1: 38,074,333 M551K possibly damaging Het
Serpinb9c A C 13: 33,150,094 C322G probably benign Het
Slc28a3 C T 13: 58,563,010 probably null Het
Slc35e4 A T 11: 3,912,970 V73E probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vps13d G A 4: 145,141,340 T1974M probably damaging Het
Wdr25 T A 12: 109,027,282 C475S probably benign Het
Zfp202 C A 9: 40,208,425 H175N probably benign Het
Zfp248 TTAAATTCAT TT 6: 118,430,194 probably null Het
Other mutations in Trim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Trim5 APN 7 104279431 missense probably damaging 1.00
IGL02165:Trim5 APN 7 104279359 missense probably damaging 1.00
IGL02576:Trim5 APN 7 104278417 missense probably damaging 0.97
IGL02660:Trim5 APN 7 104266218 missense probably damaging 0.96
IGL02732:Trim5 APN 7 104278465 missense probably benign 0.02
R0278:Trim5 UTSW 7 104279675 missense probably benign 0.00
R0373:Trim5 UTSW 7 104265684 missense probably benign 0.00
R0508:Trim5 UTSW 7 104265604 missense probably null 0.98
R0840:Trim5 UTSW 7 104265771 missense probably damaging 1.00
R0947:Trim5 UTSW 7 104265751 missense probably damaging 1.00
R1432:Trim5 UTSW 7 104279519 missense probably benign 0.04
R1432:Trim5 UTSW 7 104279521 missense probably benign
R1770:Trim5 UTSW 7 104276661 missense probably damaging 1.00
R1782:Trim5 UTSW 7 104265816 unclassified probably null
R1988:Trim5 UTSW 7 104265621 missense probably damaging 0.99
R2140:Trim5 UTSW 7 104276791 nonsense probably null
R3110:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3112:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3893:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R4114:Trim5 UTSW 7 104265740 missense probably damaging 0.99
R4249:Trim5 UTSW 7 104276815 missense possibly damaging 0.83
R4352:Trim5 UTSW 7 104276808 missense probably damaging 1.00
R4595:Trim5 UTSW 7 104265432 missense probably damaging 1.00
R5057:Trim5 UTSW 7 104265423 missense probably damaging 1.00
R5583:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R5861:Trim5 UTSW 7 104279519 missense probably benign 0.04
R5861:Trim5 UTSW 7 104279521 missense probably benign
R7027:Trim5 UTSW 7 104265668 missense probably benign 0.00
R7078:Trim5 UTSW 7 104278474 missense possibly damaging 0.85
R7150:Trim5 UTSW 7 104276810 missense probably damaging 0.96
R7657:Trim5 UTSW 7 104276677 missense possibly damaging 0.51
R7660:Trim5 UTSW 7 104279362 missense probably damaging 1.00
Z1088:Trim5 UTSW 7 104266225 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGACAGTCATTTCCCACCTG -3'
(R):5'- GTAAGACCTTCCCAACACTTCG -3'

Sequencing Primer
(F):5'- GACAGTCATTTCCCACCTGAGATG -3'
(R):5'- ATTGTATTCATGTGACTGGCATCTC -3'
Posted On2015-04-17