Incidental Mutation 'R3949:Ino80d'
ID307806
Institutional Source Beutler Lab
Gene Symbol Ino80d
Ensembl Gene ENSMUSG00000040865
Gene NameINO80 complex subunit D
SynonymsA430093A21Rik
MMRRC Submission 040929-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R3949 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location62958418-63114667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63074503 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 263 (Q263K)
Ref Sequence ENSEMBL: ENSMUSP00000127378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097718] [ENSMUST00000133236] [ENSMUST00000137511] [ENSMUST00000153992] [ENSMUST00000165066] [ENSMUST00000172416]
Predicted Effect probably benign
Transcript: ENSMUST00000097718
AA Change: Q263K

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095325
Gene: ENSMUSG00000040865
AA Change: Q263K

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 1.2e-22 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118179
Predicted Effect probably benign
Transcript: ENSMUST00000133236
AA Change: Q263K

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123430
Gene: ENSMUSG00000040865
AA Change: Q263K

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 337 401 4.3e-20 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137511
AA Change: Q263K

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000119118
Gene: ENSMUSG00000040865
AA Change: Q263K

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 4.3e-23 PFAM
low complexity region 414 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153992
AA Change: Q263K

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115332
Gene: ENSMUSG00000040865
AA Change: Q263K

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 4.3e-23 PFAM
low complexity region 414 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165066
AA Change: Q368K

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130864
Gene: ENSMUSG00000040865
AA Change: Q368K

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 18 79 5.9e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
low complexity region 258 263 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
Pfam:zf-C3Hc3H 442 506 7e-21 PFAM
low complexity region 519 564 N/A INTRINSIC
low complexity region 640 654 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
low complexity region 811 827 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
low complexity region 995 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172416
AA Change: Q263K

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127378
Gene: ENSMUSG00000040865
AA Change: Q263K

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 1.2e-22 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,570,419 M314L probably damaging Het
Apcs A G 1: 172,894,692 F29S probably damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Avl9 T C 6: 56,728,665 probably null Het
Ccdc130 A G 8: 84,258,824 V272A probably benign Het
Ccdc38 A G 10: 93,550,219 M66V probably damaging Het
Cfap46 T C 7: 139,678,551 K269E probably benign Het
Chrdl2 A C 7: 100,029,205 E328A possibly damaging Het
D430041D05Rik T C 2: 104,257,368 N421S probably benign Het
Dbndd1 G T 8: 123,506,734 Q207K probably benign Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fan1 C A 7: 64,371,544 E591* probably null Het
Fpr1 C A 17: 17,876,929 C266F probably benign Het
Gata4 C T 14: 63,240,697 R151H possibly damaging Het
Gipr T C 7: 19,157,429 N441S probably benign Het
Ipo13 A G 4: 117,901,042 I708T probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Kctd8 C T 5: 69,341,274 G10S probably benign Het
Lamb1 A C 12: 31,282,649 K257Q probably damaging Het
Lcp1 A G 14: 75,206,129 N195S possibly damaging Het
Olfr1298 A T 2: 111,645,526 I157K possibly damaging Het
Olfr1480 T C 19: 13,530,020 S160P probably damaging Het
Paxbp1 T C 16: 91,044,017 D113G probably damaging Het
Pcdhb7 T C 18: 37,343,088 S426P probably benign Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Pld2 A G 11: 70,553,354 D492G probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrf1 A C 9: 89,981,744 probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Serpinb10 T A 1: 107,540,906 L170H probably damaging Het
Sfxn4 A G 19: 60,852,063 Y165H probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Slco5a1 A T 1: 12,989,609 V296D probably damaging Het
Syn2 T A 6: 115,227,329 probably null Het
Tbx2 C T 11: 85,838,275 Q495* probably null Het
Trav6-1 G A 14: 52,638,536 V8M probably benign Het
Usp7 A T 16: 8,716,564 N46K probably damaging Het
Vmn2r58 A T 7: 41,863,924 F432I probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Washc2 T C 6: 116,208,204 probably benign Het
Other mutations in Ino80d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Ino80d APN 1 63093303 missense probably damaging 1.00
IGL01552:Ino80d APN 1 63057977 utr 3 prime probably benign
IGL01960:Ino80d APN 1 63058147 missense probably damaging 0.98
IGL02374:Ino80d APN 1 63086061 missense possibly damaging 0.63
IGL03201:Ino80d APN 1 63058308 missense probably damaging 1.00
IGL03248:Ino80d APN 1 63068182 critical splice donor site probably null
Creepy UTSW 1 63079047 missense possibly damaging 0.88
Friable UTSW 1 63062126 missense probably damaging 1.00
Herpes UTSW 1 63065834 missense probably damaging 1.00
PIT4696001:Ino80d UTSW 1 63085986 missense probably benign
R0153:Ino80d UTSW 1 63058318 missense probably damaging 0.97
R0371:Ino80d UTSW 1 63057956 utr 3 prime probably benign
R0416:Ino80d UTSW 1 63086276 missense possibly damaging 0.93
R1738:Ino80d UTSW 1 63093465 missense probably damaging 1.00
R2341:Ino80d UTSW 1 63065826 missense possibly damaging 0.75
R2351:Ino80d UTSW 1 63085835 missense probably benign 0.00
R2870:Ino80d UTSW 1 63061039 critical splice donor site probably null
R2870:Ino80d UTSW 1 63061039 critical splice donor site probably null
R3814:Ino80d UTSW 1 63074424 missense probably benign 0.05
R3828:Ino80d UTSW 1 63062078 missense possibly damaging 0.94
R3947:Ino80d UTSW 1 63074503 missense probably benign 0.16
R5180:Ino80d UTSW 1 63086329 start gained probably benign
R5301:Ino80d UTSW 1 63074419 missense probably benign
R5338:Ino80d UTSW 1 63058939 missense probably benign 0.34
R5634:Ino80d UTSW 1 63062283 intron probably benign
R5716:Ino80d UTSW 1 63058697 missense probably benign 0.01
R5841:Ino80d UTSW 1 63058840 missense probably damaging 1.00
R6219:Ino80d UTSW 1 63079047 missense possibly damaging 0.88
R6222:Ino80d UTSW 1 63058525 missense probably damaging 0.99
R6283:Ino80d UTSW 1 63062126 missense probably damaging 1.00
R6720:Ino80d UTSW 1 63058610 missense probably damaging 1.00
R6835:Ino80d UTSW 1 63074326 missense probably benign
R6897:Ino80d UTSW 1 63065834 missense probably damaging 1.00
R7162:Ino80d UTSW 1 63065735 missense probably damaging 1.00
R7403:Ino80d UTSW 1 63062219 missense possibly damaging 0.52
R7644:Ino80d UTSW 1 63058771 missense probably benign 0.18
R7816:Ino80d UTSW 1 63086397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGGCTCTAACCTGGC -3'
(R):5'- AAGTCTTGTCTTCAGCGCTAC -3'

Sequencing Primer
(F):5'- TCTAACCTGGCTCGGCTG -3'
(R):5'- AGCGCTACTGGAATTACTCCTGG -3'
Posted On2015-04-17