Incidental Mutation 'R3949:Kctd8'
ID307813
Institutional Source Beutler Lab
Gene Symbol Kctd8
Ensembl Gene ENSMUSG00000037653
Gene Namepotassium channel tetramerisation domain containing 8
Synonyms
MMRRC Submission 040929-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3949 (G1)
Quality Score130
Status Validated
Chromosome5
Chromosomal Location69109285-69341679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69341274 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 10 (G10S)
Ref Sequence ENSEMBL: ENSMUSP00000084484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054095] [ENSMUST00000087231]
Predicted Effect probably benign
Transcript: ENSMUST00000054095
AA Change: G10S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055326
Gene: ENSMUSG00000037653
AA Change: G10S

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
BTB 44 154 1.46e-8 SMART
low complexity region 172 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087231
AA Change: G10S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084484
Gene: ENSMUSG00000037653
AA Change: G10S

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
BTB 44 154 1.46e-8 SMART
low complexity region 172 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175388
Meta Mutation Damage Score 0.0669 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,570,419 M314L probably damaging Het
Apcs A G 1: 172,894,692 F29S probably damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Avl9 T C 6: 56,728,665 probably null Het
Ccdc130 A G 8: 84,258,824 V272A probably benign Het
Ccdc38 A G 10: 93,550,219 M66V probably damaging Het
Cfap46 T C 7: 139,678,551 K269E probably benign Het
Chrdl2 A C 7: 100,029,205 E328A possibly damaging Het
D430041D05Rik T C 2: 104,257,368 N421S probably benign Het
Dbndd1 G T 8: 123,506,734 Q207K probably benign Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fan1 C A 7: 64,371,544 E591* probably null Het
Fpr1 C A 17: 17,876,929 C266F probably benign Het
Gata4 C T 14: 63,240,697 R151H possibly damaging Het
Gipr T C 7: 19,157,429 N441S probably benign Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Ipo13 A G 4: 117,901,042 I708T probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Lamb1 A C 12: 31,282,649 K257Q probably damaging Het
Lcp1 A G 14: 75,206,129 N195S possibly damaging Het
Olfr1298 A T 2: 111,645,526 I157K possibly damaging Het
Olfr1480 T C 19: 13,530,020 S160P probably damaging Het
Paxbp1 T C 16: 91,044,017 D113G probably damaging Het
Pcdhb7 T C 18: 37,343,088 S426P probably benign Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Pld2 A G 11: 70,553,354 D492G probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrf1 A C 9: 89,981,744 probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Serpinb10 T A 1: 107,540,906 L170H probably damaging Het
Sfxn4 A G 19: 60,852,063 Y165H probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Slco5a1 A T 1: 12,989,609 V296D probably damaging Het
Syn2 T A 6: 115,227,329 probably null Het
Tbx2 C T 11: 85,838,275 Q495* probably null Het
Trav6-1 G A 14: 52,638,536 V8M probably benign Het
Usp7 A T 16: 8,716,564 N46K probably damaging Het
Vmn2r58 A T 7: 41,863,924 F432I probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Washc2 T C 6: 116,208,204 probably benign Het
Other mutations in Kctd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Kctd8 APN 5 69340364 missense possibly damaging 0.90
IGL02212:Kctd8 APN 5 69340688 missense probably benign 0.00
IGL03276:Kctd8 APN 5 69340586 missense possibly damaging 0.71
R0206:Kctd8 UTSW 5 69341165 missense probably damaging 1.00
R0349:Kctd8 UTSW 5 69341010 missense probably damaging 1.00
R1775:Kctd8 UTSW 5 69340560 missense probably damaging 1.00
R1782:Kctd8 UTSW 5 69340976 missense possibly damaging 0.95
R1820:Kctd8 UTSW 5 69340341 missense probably damaging 1.00
R2199:Kctd8 UTSW 5 69341245 missense probably benign 0.02
R2237:Kctd8 UTSW 5 69110409 missense probably damaging 0.98
R2513:Kctd8 UTSW 5 69110645 missense probably benign
R4418:Kctd8 UTSW 5 69341162 missense probably damaging 1.00
R4722:Kctd8 UTSW 5 69341201 missense possibly damaging 0.93
R4765:Kctd8 UTSW 5 69340848 missense possibly damaging 0.71
R5009:Kctd8 UTSW 5 69110733 missense probably benign 0.01
R5818:Kctd8 UTSW 5 69296711 missense probably benign
R5821:Kctd8 UTSW 5 69110485 missense probably benign 0.20
R6857:Kctd8 UTSW 5 69296702 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCTGAGTAACGTCGAATG -3'
(R):5'- GAGGTCCATTCCTGAGAGTCTC -3'

Sequencing Primer
(F):5'- AACGTCGAATGCTTGGTCAC -3'
(R):5'- TGAGAGTCTCTCCCCGATG -3'
Posted On2015-04-17