Incidental Mutation 'R0377:Opn3'
ID30782
Institutional Source Beutler Lab
Gene Symbol Opn3
Ensembl Gene ENSMUSG00000026525
Gene Nameopsin 3
SynonymsEcpn, encephalopsin, panopsin, ERO
MMRRC Submission 038583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0377 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175662421-175692776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 175663694 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 258 (M258V)
Ref Sequence ENSEMBL: ENSMUSP00000027809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027809] [ENSMUST00000040250] [ENSMUST00000097458] [ENSMUST00000140474]
Predicted Effect probably damaging
Transcript: ENSMUST00000027809
AA Change: M258V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027809
Gene: ENSMUSG00000026525
AA Change: M258V

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7tm_1 56 307 4.7e-36 PFAM
low complexity region 314 331 N/A INTRINSIC
low complexity region 363 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040250
SMART Domains Protein: ENSMUSP00000038914
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.6e-22 PFAM
Pfam:NAD_binding_8 13 63 2.2e-7 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097458
SMART Domains Protein: ENSMUSP00000095067
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.8e-22 PFAM
Pfam:NAD_binding_8 13 63 2.1e-7 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140474
SMART Domains Protein: ENSMUSP00000122943
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 44 240 2.9e-10 PFAM
Meta Mutation Damage Score 0.2454 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. In addition to the visual opsins, mammals possess several photoreceptive non-visual opsins that are expressed in extraocular tissues. This gene, opsin 3, is strongly expressed in brain and testis and weakly expressed in liver, placenta, heart, lung, skeletal muscle, kidney, and pancreas. The gene may also be expressed in the retina. The protein has the canonical features of a photoreceptive opsin protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice exhibit normal photoentrainment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 V107F possibly damaging Het
Acad11 T A 9: 104,081,692 probably benign Het
Ache G A 5: 137,290,928 E299K possibly damaging Het
Adam5 T C 8: 24,747,541 T618A probably benign Het
Amigo2 T A 15: 97,246,380 T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 probably null Het
Armc4 G A 18: 7,127,415 R933C probably benign Het
Btaf1 A G 19: 36,989,002 K1057E probably benign Het
Cep55 T A 19: 38,071,889 L396* probably null Het
Cic C A 7: 25,285,799 H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 C1319S probably benign Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Dntt G A 19: 41,047,627 W369* probably null Het
Esp18 T A 17: 39,409,944 W27R probably benign Het
Fam227b A T 2: 126,125,000 probably benign Het
Fbxo31 G A 8: 121,559,102 probably benign Het
Gm13547 G A 2: 29,761,791 probably null Het
Gnl2 T A 4: 125,046,382 probably benign Het
Gpx2 G A 12: 76,795,156 Q74* probably null Het
Gucy2c A G 6: 136,750,917 probably null Het
Hoxa5 A T 6: 52,202,646 W250R probably damaging Het
Izumo4 G A 10: 80,702,840 R42H probably damaging Het
Kcnj12 G A 11: 61,069,396 M71I probably benign Het
Kmt2b A T 7: 30,574,193 L2333Q probably damaging Het
Mak T C 13: 41,049,348 E177G probably damaging Het
Map3k7 T A 4: 31,985,731 I218N probably damaging Het
Mark3 T C 12: 111,629,029 L393P probably damaging Het
Msh4 A G 3: 153,896,890 S234P probably benign Het
Mug1 A G 6: 121,857,361 D367G probably benign Het
Mypn A G 10: 63,127,622 probably benign Het
Ncapg T C 5: 45,693,817 V784A probably benign Het
Nutf2 T A 8: 105,878,872 V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 D180E probably damaging Het
Osbpl7 A G 11: 97,055,934 D211G probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plekhd1 G A 12: 80,706,436 probably benign Het
Pnpla6 A G 8: 3,541,501 E1165G probably damaging Het
Prkab2 T A 3: 97,662,317 D66E probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 S885R possibly damaging Het
Rab26 A T 17: 24,530,045 probably benign Het
Rab5a G A 17: 53,500,462 M175I probably benign Het
Rassf9 T A 10: 102,545,649 D297E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 L263F probably benign Het
Sec14l1 T G 11: 117,149,140 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca1 T C 4: 34,044,267 probably null Het
Stk36 C T 1: 74,612,730 P394L probably benign Het
Stk4 T C 2: 164,096,800 I196T probably damaging Het
Sult1b1 A T 5: 87,517,376 M233K probably damaging Het
Tmem8b C T 4: 43,674,005 T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 T104P probably benign Het
Trmt2a G A 16: 18,249,703 R80Q possibly damaging Het
Trps1 C A 15: 50,831,778 E324* probably null Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Wdr18 G A 10: 79,967,502 R400H probably benign Het
Wdr78 A G 4: 103,048,259 V775A probably damaging Het
Zfp119b T A 17: 55,938,671 H505L probably damaging Het
Zfp619 T A 7: 39,536,797 C750* probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Opn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0349:Opn3 UTSW 1 175692304 missense probably damaging 1.00
R2040:Opn3 UTSW 1 175663579 missense possibly damaging 0.73
R2351:Opn3 UTSW 1 175692511 missense probably benign
R4868:Opn3 UTSW 1 175663561 missense probably damaging 1.00
R5561:Opn3 UTSW 1 175665587 missense probably damaging 1.00
R6232:Opn3 UTSW 1 175663103 missense probably damaging 0.99
R6848:Opn3 UTSW 1 175663049 missense probably damaging 1.00
R7275:Opn3 UTSW 1 175665473 missense probably damaging 1.00
R7522:Opn3 UTSW 1 175665623 missense probably benign 0.08
R7774:Opn3 UTSW 1 175662905 missense probably damaging 0.99
Z1177:Opn3 UTSW 1 175692663 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCTCCTTGTTACCCAGAGTGGAAAAG -3'
(R):5'- TCAGAAGTCAACCTCCTGTGGACC -3'

Sequencing Primer
(F):5'- TCTGTAATGCTGGAGCTTACC -3'
(R):5'- CTTTACTTTCCCGGAAGACAGG -3'
Posted On2013-04-24