Incidental Mutation 'R3949:Cfap46'
ID 307822
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik, Ttc40
MMRRC Submission 040929-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3949 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 139180867-139263733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139258467 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 269 (K269E)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000130453] [ENSMUST00000140820]
AlphaFold E9Q2C0
Predicted Effect probably benign
Transcript: ENSMUST00000129990
AA Change: K269E

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: K269E

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130453
SMART Domains Protein: ENSMUSP00000115437
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 116 149 1e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138129
Predicted Effect probably benign
Transcript: ENSMUST00000140820
AA Change: K269E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571
AA Change: K269E

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156116
Meta Mutation Damage Score 0.1231 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,620,455 (GRCm39) M314L probably damaging Het
Apcs A G 1: 172,722,259 (GRCm39) F29S probably damaging Het
Arfgef1 CAGAG CAG 1: 10,212,811 (GRCm39) probably null Het
Avl9 T C 6: 56,705,650 (GRCm39) probably null Het
Ccdc38 A G 10: 93,386,081 (GRCm39) M66V probably damaging Het
Chrdl2 A C 7: 99,678,412 (GRCm39) E328A possibly damaging Het
D430041D05Rik T C 2: 104,087,713 (GRCm39) N421S probably benign Het
Dbndd1 G T 8: 124,233,473 (GRCm39) Q207K probably benign Het
Disc1 A G 8: 125,814,874 (GRCm39) E246G probably damaging Het
Dyrk4 A G 6: 126,862,268 (GRCm39) I408T probably damaging Het
Entpd7 G A 19: 43,679,597 (GRCm39) R50Q probably benign Het
Fan1 C A 7: 64,021,292 (GRCm39) E591* probably null Het
Fpr1 C A 17: 18,097,191 (GRCm39) C266F probably benign Het
Gata4 C T 14: 63,478,146 (GRCm39) R151H possibly damaging Het
Gipr T C 7: 18,891,354 (GRCm39) N441S probably benign Het
Ino80d G T 1: 63,113,662 (GRCm39) Q263K probably benign Het
Ipo13 A G 4: 117,758,239 (GRCm39) I708T probably benign Het
Iqsec3 A T 6: 121,364,783 (GRCm39) Y835* probably null Het
Kctd8 C T 5: 69,498,617 (GRCm39) G10S probably benign Het
Lamb1 A C 12: 31,332,648 (GRCm39) K257Q probably damaging Het
Lcp1 A G 14: 75,443,569 (GRCm39) N195S possibly damaging Het
Or4k48 A T 2: 111,475,871 (GRCm39) I157K possibly damaging Het
Or5b121 T C 19: 13,507,384 (GRCm39) S160P probably damaging Het
Paxbp1 T C 16: 90,840,905 (GRCm39) D113G probably damaging Het
Pcdhb7 T C 18: 37,476,141 (GRCm39) S426P probably benign Het
Pcnx4 A G 12: 72,603,076 (GRCm39) D446G probably benign Het
Pkd1 T A 17: 24,797,011 (GRCm39) probably benign Het
Pld2 A G 11: 70,444,180 (GRCm39) D492G probably benign Het
Ranbp17 G A 11: 33,429,189 (GRCm39) A352V probably benign Het
Rasgrf1 A C 9: 89,863,797 (GRCm39) probably benign Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Serpinb10 T A 1: 107,468,636 (GRCm39) L170H probably damaging Het
Sfxn4 A G 19: 60,840,501 (GRCm39) Y165H probably damaging Het
Slc32a1 C T 2: 158,453,152 (GRCm39) probably benign Het
Slco5a1 A T 1: 13,059,833 (GRCm39) V296D probably damaging Het
Syn2 T A 6: 115,204,290 (GRCm39) probably null Het
Tbx2 C T 11: 85,729,101 (GRCm39) Q495* probably null Het
Trav6-1 G A 14: 52,875,993 (GRCm39) V8M probably benign Het
Usp7 A T 16: 8,534,428 (GRCm39) N46K probably damaging Het
Vmn2r58 A T 7: 41,513,348 (GRCm39) F432I probably benign Het
Vmn2r99 T C 17: 19,599,252 (GRCm39) M312T probably benign Het
Washc2 T C 6: 116,185,165 (GRCm39) probably benign Het
Yju2b A G 8: 84,985,453 (GRCm39) V272A probably benign Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139,194,359 (GRCm39) missense probably benign 0.06
IGL00505:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139,246,895 (GRCm39) missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139,186,523 (GRCm39) missense unknown
IGL02171:Cfap46 APN 7 139,246,972 (GRCm39) missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139,262,425 (GRCm39) missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139,194,386 (GRCm39) missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139,187,117 (GRCm39) missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139,183,168 (GRCm39) missense unknown
IGL03329:Cfap46 APN 7 139,181,081 (GRCm39) missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139,218,711 (GRCm39) utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139,218,846 (GRCm39) utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139,218,846 (GRCm39) utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139,225,467 (GRCm39) missense
R0051:Cfap46 UTSW 7 139,255,951 (GRCm39) missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139,255,951 (GRCm39) missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139,234,482 (GRCm39) missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139,231,449 (GRCm39) splice site probably benign
R0650:Cfap46 UTSW 7 139,185,571 (GRCm39) missense unknown
R0675:Cfap46 UTSW 7 139,255,950 (GRCm39) missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139,234,586 (GRCm39) missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139,235,757 (GRCm39) missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139,222,513 (GRCm39) missense probably benign 0.42
R1251:Cfap46 UTSW 7 139,181,181 (GRCm39) missense probably benign 0.40
R1257:Cfap46 UTSW 7 139,234,545 (GRCm39) nonsense probably null
R1538:Cfap46 UTSW 7 139,262,924 (GRCm39) missense probably null 1.00
R1618:Cfap46 UTSW 7 139,232,726 (GRCm39) missense probably benign 0.04
R1655:Cfap46 UTSW 7 139,222,436 (GRCm39) nonsense probably null
R1824:Cfap46 UTSW 7 139,219,518 (GRCm39) missense probably benign 0.12
R1830:Cfap46 UTSW 7 139,220,323 (GRCm39) missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139,233,324 (GRCm39) missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139,263,386 (GRCm39) missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139,259,819 (GRCm39) missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139,246,957 (GRCm39) missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139,263,677 (GRCm39) missense probably benign 0.03
R2354:Cfap46 UTSW 7 139,240,962 (GRCm39) missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139,233,414 (GRCm39) missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139,197,506 (GRCm39) missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139,219,515 (GRCm39) missense probably benign 0.06
R4239:Cfap46 UTSW 7 139,246,203 (GRCm39) missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139,246,203 (GRCm39) missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139,232,589 (GRCm39) missense probably benign 0.27
R4365:Cfap46 UTSW 7 139,230,868 (GRCm39) missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139,239,998 (GRCm39) intron probably benign
R4595:Cfap46 UTSW 7 139,232,320 (GRCm39) missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4627:Cfap46 UTSW 7 139,237,197 (GRCm39) missense probably damaging 0.99
R4628:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139,207,372 (GRCm39) missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139,259,239 (GRCm39) critical splice donor site probably null
R4771:Cfap46 UTSW 7 139,210,524 (GRCm39) missense probably null
R4779:Cfap46 UTSW 7 139,239,731 (GRCm39) intron probably benign
R4812:Cfap46 UTSW 7 139,215,916 (GRCm39) missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139,187,104 (GRCm39) critical splice donor site probably null
R5014:Cfap46 UTSW 7 139,207,291 (GRCm39) missense probably benign 0.12
R5033:Cfap46 UTSW 7 139,183,776 (GRCm39) missense probably benign 0.00
R5055:Cfap46 UTSW 7 139,241,106 (GRCm39) missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139,258,430 (GRCm39) missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139,193,423 (GRCm39) critical splice donor site probably null
R5366:Cfap46 UTSW 7 139,230,802 (GRCm39) missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139,207,389 (GRCm39) missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139,212,097 (GRCm39) splice site probably null
R5642:Cfap46 UTSW 7 139,258,493 (GRCm39) missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139,218,269 (GRCm39) missense probably benign 0.01
R5691:Cfap46 UTSW 7 139,186,616 (GRCm39) missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139,191,947 (GRCm39) missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139,230,858 (GRCm39) missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139,231,511 (GRCm39) missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139,236,496 (GRCm39) missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139,241,001 (GRCm39) missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139,260,747 (GRCm39) missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139,194,321 (GRCm39) critical splice donor site probably null
R6736:Cfap46 UTSW 7 139,199,887 (GRCm39) missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139,232,356 (GRCm39) missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139,222,477 (GRCm39) utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139,232,414 (GRCm39) missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139,234,477 (GRCm39) critical splice donor site probably null
R6912:Cfap46 UTSW 7 139,219,616 (GRCm39) missense probably benign 0.09
R7163:Cfap46 UTSW 7 139,197,994 (GRCm39) critical splice donor site probably null
R7232:Cfap46 UTSW 7 139,197,493 (GRCm39) missense unknown
R7327:Cfap46 UTSW 7 139,215,062 (GRCm39) splice site probably null
R7336:Cfap46 UTSW 7 139,200,020 (GRCm39) missense unknown
R7337:Cfap46 UTSW 7 139,210,492 (GRCm39) critical splice donor site probably null
R7437:Cfap46 UTSW 7 139,230,753 (GRCm39) nonsense probably null
R7450:Cfap46 UTSW 7 139,197,353 (GRCm39) missense unknown
R7495:Cfap46 UTSW 7 139,183,112 (GRCm39) critical splice donor site probably null
R7618:Cfap46 UTSW 7 139,183,155 (GRCm39) missense
R7623:Cfap46 UTSW 7 139,198,266 (GRCm39) missense unknown
R7765:Cfap46 UTSW 7 139,231,480 (GRCm39) missense
R7971:Cfap46 UTSW 7 139,215,043 (GRCm39) missense unknown
R8211:Cfap46 UTSW 7 139,213,220 (GRCm39) missense unknown
R8306:Cfap46 UTSW 7 139,236,496 (GRCm39) missense
R8354:Cfap46 UTSW 7 139,233,414 (GRCm39) missense probably benign 0.03
R8365:Cfap46 UTSW 7 139,263,000 (GRCm39) nonsense probably null
R8447:Cfap46 UTSW 7 139,260,902 (GRCm39) missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139,185,560 (GRCm39) missense
R8805:Cfap46 UTSW 7 139,211,979 (GRCm39) missense unknown
R8830:Cfap46 UTSW 7 139,195,565 (GRCm39) missense unknown
R8912:Cfap46 UTSW 7 139,260,097 (GRCm39) intron probably benign
R8920:Cfap46 UTSW 7 139,232,442 (GRCm39) missense
R8977:Cfap46 UTSW 7 139,259,849 (GRCm39) missense probably benign 0.01
R9048:Cfap46 UTSW 7 139,207,259 (GRCm39) missense unknown
R9224:Cfap46 UTSW 7 139,258,416 (GRCm39) nonsense probably null
R9243:Cfap46 UTSW 7 139,195,265 (GRCm39) intron probably benign
R9252:Cfap46 UTSW 7 139,198,165 (GRCm39) missense unknown
R9276:Cfap46 UTSW 7 139,201,207 (GRCm39) missense unknown
R9301:Cfap46 UTSW 7 139,222,461 (GRCm39) missense
R9391:Cfap46 UTSW 7 139,198,027 (GRCm39) missense unknown
R9402:Cfap46 UTSW 7 139,215,865 (GRCm39) missense unknown
R9443:Cfap46 UTSW 7 139,195,023 (GRCm39) missense
R9564:Cfap46 UTSW 7 139,231,471 (GRCm39) missense
R9625:Cfap46 UTSW 7 139,230,805 (GRCm39) missense
R9626:Cfap46 UTSW 7 139,230,805 (GRCm39) missense
R9638:Cfap46 UTSW 7 139,209,763 (GRCm39) missense unknown
R9656:Cfap46 UTSW 7 139,235,816 (GRCm39) missense
R9658:Cfap46 UTSW 7 139,246,229 (GRCm39) missense
R9747:Cfap46 UTSW 7 139,191,907 (GRCm39) missense unknown
RF023:Cfap46 UTSW 7 139,218,834 (GRCm39)
W0251:Cfap46 UTSW 7 139,183,862 (GRCm39) missense probably benign 0.11
X0018:Cfap46 UTSW 7 139,260,828 (GRCm39) missense probably benign 0.03
X0064:Cfap46 UTSW 7 139,183,363 (GRCm39) missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139,214,980 (GRCm39) missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139,219,464 (GRCm39) missense
Z1177:Cfap46 UTSW 7 139,210,542 (GRCm39) missense unknown
Z1177:Cfap46 UTSW 7 139,181,183 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATTACCAGGGAGGCTCTAGC -3'
(R):5'- AATTTGCCCGGGAAATGAGAC -3'

Sequencing Primer
(F):5'- CAGGGAGGCTCTAGCAAACC -3'
(R):5'- CCCGGGAAATGAGACACGAAG -3'
Posted On 2015-04-17