Incidental Mutation 'R3949:Ranbp17'
ID307828
Institutional Source Beutler Lab
Gene Symbol Ranbp17
Ensembl Gene ENSMUSG00000040594
Gene NameRAN binding protein 17
Synonyms4932704E15Rik
MMRRC Submission 040929-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3949 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location33211795-33513746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33479189 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 352 (A352V)
Ref Sequence ENSEMBL: ENSMUSP00000099879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037522] [ENSMUST00000102815] [ENSMUST00000129179]
Predicted Effect probably benign
Transcript: ENSMUST00000037522
AA Change: A352V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035840
Gene: ENSMUSG00000040594
AA Change: A352V

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102815
AA Change: A352V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099879
Gene: ENSMUSG00000040594
AA Change: A352V

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129179
AA Change: A352V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137898
Gene: ENSMUSG00000040594
AA Change: A352V

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-17 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,570,419 M314L probably damaging Het
Apcs A G 1: 172,894,692 F29S probably damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Avl9 T C 6: 56,728,665 probably null Het
Ccdc130 A G 8: 84,258,824 V272A probably benign Het
Ccdc38 A G 10: 93,550,219 M66V probably damaging Het
Cfap46 T C 7: 139,678,551 K269E probably benign Het
Chrdl2 A C 7: 100,029,205 E328A possibly damaging Het
D430041D05Rik T C 2: 104,257,368 N421S probably benign Het
Dbndd1 G T 8: 123,506,734 Q207K probably benign Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fan1 C A 7: 64,371,544 E591* probably null Het
Fpr1 C A 17: 17,876,929 C266F probably benign Het
Gata4 C T 14: 63,240,697 R151H possibly damaging Het
Gipr T C 7: 19,157,429 N441S probably benign Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Ipo13 A G 4: 117,901,042 I708T probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Kctd8 C T 5: 69,341,274 G10S probably benign Het
Lamb1 A C 12: 31,282,649 K257Q probably damaging Het
Lcp1 A G 14: 75,206,129 N195S possibly damaging Het
Olfr1298 A T 2: 111,645,526 I157K possibly damaging Het
Olfr1480 T C 19: 13,530,020 S160P probably damaging Het
Paxbp1 T C 16: 91,044,017 D113G probably damaging Het
Pcdhb7 T C 18: 37,343,088 S426P probably benign Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Pld2 A G 11: 70,553,354 D492G probably benign Het
Rasgrf1 A C 9: 89,981,744 probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Serpinb10 T A 1: 107,540,906 L170H probably damaging Het
Sfxn4 A G 19: 60,852,063 Y165H probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Slco5a1 A T 1: 12,989,609 V296D probably damaging Het
Syn2 T A 6: 115,227,329 probably null Het
Tbx2 C T 11: 85,838,275 Q495* probably null Het
Trav6-1 G A 14: 52,638,536 V8M probably benign Het
Usp7 A T 16: 8,716,564 N46K probably damaging Het
Vmn2r58 A T 7: 41,863,924 F432I probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Washc2 T C 6: 116,208,204 probably benign Het
Other mutations in Ranbp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ranbp17 APN 11 33493402 missense probably benign 0.13
IGL00582:Ranbp17 APN 11 33504683 missense probably damaging 0.99
IGL00698:Ranbp17 APN 11 33441910 missense probably benign 0.00
IGL00789:Ranbp17 APN 11 33243249 missense probably benign 0.27
IGL01304:Ranbp17 APN 11 33266147 missense possibly damaging 0.91
IGL01936:Ranbp17 APN 11 33487689 missense probably benign 0.00
IGL01937:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01945:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01993:Ranbp17 APN 11 33500770 missense possibly damaging 0.48
IGL02588:Ranbp17 APN 11 33217361 missense probably benign
IGL02870:Ranbp17 APN 11 33243262 missense probably damaging 1.00
IGL03149:Ranbp17 APN 11 33243183 missense possibly damaging 0.76
PIT4445001:Ranbp17 UTSW 11 33481020 critical splice donor site probably null
PIT4480001:Ranbp17 UTSW 11 33297340 critical splice donor site probably null
R0079:Ranbp17 UTSW 11 33500682 missense probably damaging 1.00
R0349:Ranbp17 UTSW 11 33500689 missense probably benign
R0395:Ranbp17 UTSW 11 33474896 missense probably benign
R1456:Ranbp17 UTSW 11 33266310 missense probably damaging 1.00
R1539:Ranbp17 UTSW 11 33297394 missense probably damaging 0.99
R1542:Ranbp17 UTSW 11 33264672 missense probably benign
R1770:Ranbp17 UTSW 11 33217301 missense probably benign 0.31
R2216:Ranbp17 UTSW 11 33481125 missense probably damaging 1.00
R2656:Ranbp17 UTSW 11 33243122 missense probably benign
R2883:Ranbp17 UTSW 11 33504708 missense probably damaging 1.00
R3498:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3499:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3721:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3788:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3790:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3914:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3915:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4021:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4022:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4027:Ranbp17 UTSW 11 33500718 missense possibly damaging 0.67
R4421:Ranbp17 UTSW 11 33475056 missense probably benign 0.01
R4462:Ranbp17 UTSW 11 33217421 critical splice acceptor site probably null
R4659:Ranbp17 UTSW 11 33266288 missense probably damaging 1.00
R4791:Ranbp17 UTSW 11 33487746 missense probably benign 0.11
R4837:Ranbp17 UTSW 11 33328451 missense probably damaging 1.00
R4914:Ranbp17 UTSW 11 33213425 missense probably benign
R4939:Ranbp17 UTSW 11 33219223 missense probably benign 0.31
R5119:Ranbp17 UTSW 11 33404181 makesense probably null
R5171:Ranbp17 UTSW 11 33217419 missense probably benign
R5182:Ranbp17 UTSW 11 33219287 intron probably benign
R5288:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5384:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5385:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5398:Ranbp17 UTSW 11 33474998 missense probably damaging 1.00
R6658:Ranbp17 UTSW 11 33219214 nonsense probably null
R6701:Ranbp17 UTSW 11 33475066 missense probably damaging 1.00
R6796:Ranbp17 UTSW 11 33217398 missense probably benign
R6869:Ranbp17 UTSW 11 33513074 start gained probably benign
R7096:Ranbp17 UTSW 11 33474896 missense probably benign
R7156:Ranbp17 UTSW 11 33297420 missense probably damaging 1.00
X0013:Ranbp17 UTSW 11 33289562 unclassified probably null
X0024:Ranbp17 UTSW 11 33213404 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCTTTACATAGACTTCGATACCCAC -3'
(R):5'- AGTCAGTGTGCATGAGAGCC -3'

Sequencing Primer
(F):5'- GATACCCACCACTCTTTCATTACTAG -3'
(R):5'- TGTGCATGAGAGCCAGGGC -3'
Posted On2015-04-17