Incidental Mutation 'R3949:Pcnx4'
ID307832
Institutional Source Beutler Lab
Gene Symbol Pcnx4
Ensembl Gene ENSMUSG00000034501
Gene Namepecanex homolog 4
Synonyms1810048J11Rik, Pcnxl4
MMRRC Submission 040929-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R3949 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72536383-72580119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72556302 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 446 (D446G)
Ref Sequence ENSEMBL: ENSMUSP00000038916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044352]
Predicted Effect probably benign
Transcript: ENSMUST00000044352
AA Change: D446G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038916
Gene: ENSMUSG00000034501
AA Change: D446G

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 247 264 N/A INTRINSIC
transmembrane domain 296 330 N/A INTRINSIC
transmembrane domain 368 390 N/A INTRINSIC
transmembrane domain 400 417 N/A INTRINSIC
transmembrane domain 454 476 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
transmembrane domain 546 564 N/A INTRINSIC
transmembrane domain 577 599 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Pfam:Pecanex_C 999 1174 4.2e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,570,419 M314L probably damaging Het
Apcs A G 1: 172,894,692 F29S probably damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Avl9 T C 6: 56,728,665 probably null Het
Ccdc130 A G 8: 84,258,824 V272A probably benign Het
Ccdc38 A G 10: 93,550,219 M66V probably damaging Het
Cfap46 T C 7: 139,678,551 K269E probably benign Het
Chrdl2 A C 7: 100,029,205 E328A possibly damaging Het
D430041D05Rik T C 2: 104,257,368 N421S probably benign Het
Dbndd1 G T 8: 123,506,734 Q207K probably benign Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fan1 C A 7: 64,371,544 E591* probably null Het
Fpr1 C A 17: 17,876,929 C266F probably benign Het
Gata4 C T 14: 63,240,697 R151H possibly damaging Het
Gipr T C 7: 19,157,429 N441S probably benign Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Ipo13 A G 4: 117,901,042 I708T probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Kctd8 C T 5: 69,341,274 G10S probably benign Het
Lamb1 A C 12: 31,282,649 K257Q probably damaging Het
Lcp1 A G 14: 75,206,129 N195S possibly damaging Het
Olfr1298 A T 2: 111,645,526 I157K possibly damaging Het
Olfr1480 T C 19: 13,530,020 S160P probably damaging Het
Paxbp1 T C 16: 91,044,017 D113G probably damaging Het
Pcdhb7 T C 18: 37,343,088 S426P probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Pld2 A G 11: 70,553,354 D492G probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrf1 A C 9: 89,981,744 probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Serpinb10 T A 1: 107,540,906 L170H probably damaging Het
Sfxn4 A G 19: 60,852,063 Y165H probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Slco5a1 A T 1: 12,989,609 V296D probably damaging Het
Syn2 T A 6: 115,227,329 probably null Het
Tbx2 C T 11: 85,838,275 Q495* probably null Het
Trav6-1 G A 14: 52,638,536 V8M probably benign Het
Usp7 A T 16: 8,716,564 N46K probably damaging Het
Vmn2r58 A T 7: 41,863,924 F432I probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Washc2 T C 6: 116,208,204 probably benign Het
Other mutations in Pcnx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pcnx4 APN 12 72579365 missense probably damaging 0.97
IGL01160:Pcnx4 APN 12 72579377 missense probably damaging 1.00
IGL01385:Pcnx4 APN 12 72573746 missense probably damaging 1.00
IGL01452:Pcnx4 APN 12 72574400 missense possibly damaging 0.79
IGL01984:Pcnx4 APN 12 72574409 missense probably benign 0.25
IGL02073:Pcnx4 APN 12 72574328 missense possibly damaging 0.92
IGL02726:Pcnx4 APN 12 72574212 missense probably benign 0.12
IGL02824:Pcnx4 APN 12 72555571 missense probably benign 0.02
R0007:Pcnx4 UTSW 12 72555579 missense possibly damaging 0.79
R0158:Pcnx4 UTSW 12 72556302 missense probably benign
R0575:Pcnx4 UTSW 12 72567236 missense probably benign 0.00
R0783:Pcnx4 UTSW 12 72575478 missense probably damaging 1.00
R1420:Pcnx4 UTSW 12 72555986 missense probably benign
R1497:Pcnx4 UTSW 12 72574400 missense probably benign 0.03
R2093:Pcnx4 UTSW 12 72579442 missense probably damaging 1.00
R2241:Pcnx4 UTSW 12 72574154 missense probably damaging 0.99
R2287:Pcnx4 UTSW 12 72575398 missense probably benign 0.05
R2418:Pcnx4 UTSW 12 72556263 missense probably damaging 1.00
R2437:Pcnx4 UTSW 12 72541813 missense probably damaging 1.00
R2509:Pcnx4 UTSW 12 72566972 missense probably damaging 1.00
R2510:Pcnx4 UTSW 12 72566972 missense probably damaging 1.00
R2512:Pcnx4 UTSW 12 72556799 critical splice acceptor site probably null
R3691:Pcnx4 UTSW 12 72573719 missense probably damaging 1.00
R3760:Pcnx4 UTSW 12 72567006 missense probably damaging 1.00
R4065:Pcnx4 UTSW 12 72556360 critical splice donor site probably null
R4757:Pcnx4 UTSW 12 72556293 missense probably benign 0.00
R4804:Pcnx4 UTSW 12 72574202 missense probably benign 0.28
R4867:Pcnx4 UTSW 12 72573952 missense probably benign 0.01
R4879:Pcnx4 UTSW 12 72567185 missense probably damaging 1.00
R5108:Pcnx4 UTSW 12 72574081 missense probably benign 0.01
R5350:Pcnx4 UTSW 12 72579364 missense probably damaging 1.00
R5504:Pcnx4 UTSW 12 72574448 missense probably damaging 1.00
R5718:Pcnx4 UTSW 12 72567194 missense possibly damaging 0.49
R5943:Pcnx4 UTSW 12 72579458 missense probably damaging 0.99
R6195:Pcnx4 UTSW 12 72556874 missense possibly damaging 0.92
R7134:Pcnx4 UTSW 12 72566976 missense probably damaging 0.96
R7695:Pcnx4 UTSW 12 72541576 missense probably benign 0.00
R7837:Pcnx4 UTSW 12 72556118 missense probably damaging 1.00
R7850:Pcnx4 UTSW 12 72556068 missense probably benign
R7920:Pcnx4 UTSW 12 72556118 missense probably damaging 1.00
R7933:Pcnx4 UTSW 12 72556068 missense probably benign
R8153:Pcnx4 UTSW 12 72556243 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGCTGCTGCATCACTATG -3'
(R):5'- TTGGTAAATAGCTTTCGTGGGCAC -3'

Sequencing Primer
(F):5'- GCTGCATCACTATGTCAGCG -3'
(R):5'- CGTGGGCACATTTAAGCAATTAGC -3'
Posted On2015-04-17