Incidental Mutation 'R3949:Lcp1'
ID 307835
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Name lymphocyte cytosolic protein 1
Synonyms L-fimbrin, L-plastin, D14Ertd310e, Pls2
MMRRC Submission 040929-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3949 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 75368545-75468282 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75443569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 195 (N195S)
Ref Sequence ENSEMBL: ENSMUSP00000116271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124499] [ENSMUST00000131802] [ENSMUST00000145303]
AlphaFold Q61233
Predicted Effect possibly damaging
Transcript: ENSMUST00000124499
AA Change: N195S

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: N195S

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131802
AA Change: N195S

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: N195S

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145303
AA Change: N195S

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: N195S

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Meta Mutation Damage Score 0.1397 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,620,455 (GRCm39) M314L probably damaging Het
Apcs A G 1: 172,722,259 (GRCm39) F29S probably damaging Het
Arfgef1 CAGAG CAG 1: 10,212,811 (GRCm39) probably null Het
Avl9 T C 6: 56,705,650 (GRCm39) probably null Het
Ccdc38 A G 10: 93,386,081 (GRCm39) M66V probably damaging Het
Cfap46 T C 7: 139,258,467 (GRCm39) K269E probably benign Het
Chrdl2 A C 7: 99,678,412 (GRCm39) E328A possibly damaging Het
D430041D05Rik T C 2: 104,087,713 (GRCm39) N421S probably benign Het
Dbndd1 G T 8: 124,233,473 (GRCm39) Q207K probably benign Het
Disc1 A G 8: 125,814,874 (GRCm39) E246G probably damaging Het
Dyrk4 A G 6: 126,862,268 (GRCm39) I408T probably damaging Het
Entpd7 G A 19: 43,679,597 (GRCm39) R50Q probably benign Het
Fan1 C A 7: 64,021,292 (GRCm39) E591* probably null Het
Fpr1 C A 17: 18,097,191 (GRCm39) C266F probably benign Het
Gata4 C T 14: 63,478,146 (GRCm39) R151H possibly damaging Het
Gipr T C 7: 18,891,354 (GRCm39) N441S probably benign Het
Ino80d G T 1: 63,113,662 (GRCm39) Q263K probably benign Het
Ipo13 A G 4: 117,758,239 (GRCm39) I708T probably benign Het
Iqsec3 A T 6: 121,364,783 (GRCm39) Y835* probably null Het
Kctd8 C T 5: 69,498,617 (GRCm39) G10S probably benign Het
Lamb1 A C 12: 31,332,648 (GRCm39) K257Q probably damaging Het
Or4k48 A T 2: 111,475,871 (GRCm39) I157K possibly damaging Het
Or5b121 T C 19: 13,507,384 (GRCm39) S160P probably damaging Het
Paxbp1 T C 16: 90,840,905 (GRCm39) D113G probably damaging Het
Pcdhb7 T C 18: 37,476,141 (GRCm39) S426P probably benign Het
Pcnx4 A G 12: 72,603,076 (GRCm39) D446G probably benign Het
Pkd1 T A 17: 24,797,011 (GRCm39) probably benign Het
Pld2 A G 11: 70,444,180 (GRCm39) D492G probably benign Het
Ranbp17 G A 11: 33,429,189 (GRCm39) A352V probably benign Het
Rasgrf1 A C 9: 89,863,797 (GRCm39) probably benign Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Serpinb10 T A 1: 107,468,636 (GRCm39) L170H probably damaging Het
Sfxn4 A G 19: 60,840,501 (GRCm39) Y165H probably damaging Het
Slc32a1 C T 2: 158,453,152 (GRCm39) probably benign Het
Slco5a1 A T 1: 13,059,833 (GRCm39) V296D probably damaging Het
Syn2 T A 6: 115,204,290 (GRCm39) probably null Het
Tbx2 C T 11: 85,729,101 (GRCm39) Q495* probably null Het
Trav6-1 G A 14: 52,875,993 (GRCm39) V8M probably benign Het
Usp7 A T 16: 8,534,428 (GRCm39) N46K probably damaging Het
Vmn2r58 A T 7: 41,513,348 (GRCm39) F432I probably benign Het
Vmn2r99 T C 17: 19,599,252 (GRCm39) M312T probably benign Het
Washc2 T C 6: 116,185,165 (GRCm39) probably benign Het
Yju2b A G 8: 84,985,453 (GRCm39) V272A probably benign Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75,464,533 (GRCm39) critical splice donor site probably null
IGL01768:Lcp1 APN 14 75,461,573 (GRCm39) missense probably benign 0.40
IGL01801:Lcp1 APN 14 75,436,815 (GRCm39) missense probably benign 0.10
IGL01940:Lcp1 APN 14 75,453,805 (GRCm39) missense probably benign 0.17
IGL02135:Lcp1 APN 14 75,437,926 (GRCm39) missense probably benign 0.00
IGL02185:Lcp1 APN 14 75,466,740 (GRCm39) missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75,461,536 (GRCm39) missense probably benign 0.04
IGL02604:Lcp1 APN 14 75,461,566 (GRCm39) missense probably benign 0.11
R0244:Lcp1 UTSW 14 75,464,441 (GRCm39) missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75,436,860 (GRCm39) missense probably null 0.59
R0313:Lcp1 UTSW 14 75,436,873 (GRCm39) missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R0811:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R0812:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R1200:Lcp1 UTSW 14 75,466,742 (GRCm39) missense possibly damaging 0.73
R1713:Lcp1 UTSW 14 75,436,884 (GRCm39) critical splice donor site probably null
R1915:Lcp1 UTSW 14 75,436,737 (GRCm39) missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75,437,841 (GRCm39) missense probably benign 0.01
R2064:Lcp1 UTSW 14 75,435,515 (GRCm39) critical splice acceptor site probably null
R4062:Lcp1 UTSW 14 75,452,620 (GRCm39) missense probably damaging 1.00
R4521:Lcp1 UTSW 14 75,452,608 (GRCm39) missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75,437,848 (GRCm39) missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75,437,929 (GRCm39) missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75,445,911 (GRCm39) nonsense probably null
R5539:Lcp1 UTSW 14 75,466,738 (GRCm39) missense probably benign 0.08
R5561:Lcp1 UTSW 14 75,449,948 (GRCm39) missense probably benign 0.01
R5724:Lcp1 UTSW 14 75,464,422 (GRCm39) missense probably benign 0.18
R5989:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R6731:Lcp1 UTSW 14 75,443,629 (GRCm39) missense probably damaging 1.00
R7346:Lcp1 UTSW 14 75,447,946 (GRCm39) missense possibly damaging 0.49
R7670:Lcp1 UTSW 14 75,437,871 (GRCm39) missense probably benign 0.12
R7698:Lcp1 UTSW 14 75,443,651 (GRCm39) nonsense probably null
R9780:Lcp1 UTSW 14 75,440,178 (GRCm39) missense probably damaging 1.00
S24628:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75,464,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTAGCTCAGTACCGTGG -3'
(R):5'- AAAGCCGTGCTGATCACAG -3'

Sequencing Primer
(F):5'- AGCTCAGTACCGTGGGTTATTAG -3'
(R):5'- GATCACAGCCTCTGACACTTTC -3'
Posted On 2015-04-17