Incidental Mutation 'R0377:Fam227b'
ID 30784
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Name family with sequence similarity 227, member B
Synonyms 4930525F21Rik
MMRRC Submission 038583-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R0377 (G1)
Quality Score 173
Status Validated
Chromosome 2
Chromosomal Location 125983483-126152004 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 126125000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
AlphaFold Q9D518
Predicted Effect probably benign
Transcript: ENSMUST00000110446
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110448
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably benign
Transcript: ENSMUST00000178118
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 (GRCm38) V107F possibly damaging Het
Acad11 T A 9: 104,081,692 (GRCm38) probably benign Het
Ache G A 5: 137,290,928 (GRCm38) E299K possibly damaging Het
Adam5 T C 8: 24,747,541 (GRCm38) T618A probably benign Het
Amigo2 T A 15: 97,246,380 (GRCm38) T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 (GRCm38) probably null Het
Armc4 G A 18: 7,127,415 (GRCm38) R933C probably benign Het
Btaf1 A G 19: 36,989,002 (GRCm38) K1057E probably benign Het
Cep55 T A 19: 38,071,889 (GRCm38) L396* probably null Het
Cic C A 7: 25,285,799 (GRCm38) H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 (GRCm38) T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 (GRCm38) C1319S probably benign Het
Dnah6 A G 6: 73,121,992 (GRCm38) S2027P possibly damaging Het
Dntt G A 19: 41,047,627 (GRCm38) W369* probably null Het
Esp18 T A 17: 39,409,944 (GRCm38) W27R probably benign Het
Fbxo31 G A 8: 121,559,102 (GRCm38) probably benign Het
Gm13547 G A 2: 29,761,791 (GRCm38) probably null Het
Gnl2 T A 4: 125,046,382 (GRCm38) probably benign Het
Gpx2 G A 12: 76,795,156 (GRCm38) Q74* probably null Het
Gucy2c A G 6: 136,750,917 (GRCm38) probably null Het
Hoxa5 A T 6: 52,202,646 (GRCm38) W250R probably damaging Het
Izumo4 G A 10: 80,702,840 (GRCm38) R42H probably damaging Het
Kcnj12 G A 11: 61,069,396 (GRCm38) M71I probably benign Het
Kmt2b A T 7: 30,574,193 (GRCm38) L2333Q probably damaging Het
Mak T C 13: 41,049,348 (GRCm38) E177G probably damaging Het
Map3k7 T A 4: 31,985,731 (GRCm38) I218N probably damaging Het
Mark3 T C 12: 111,629,029 (GRCm38) L393P probably damaging Het
Msh4 A G 3: 153,896,890 (GRCm38) S234P probably benign Het
Mug1 A G 6: 121,857,361 (GRCm38) D367G probably benign Het
Mypn A G 10: 63,127,622 (GRCm38) probably benign Het
Ncapg T C 5: 45,693,817 (GRCm38) V784A probably benign Het
Nutf2 T A 8: 105,878,872 (GRCm38) V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 (GRCm38) D180E probably damaging Het
Opn3 T C 1: 175,663,694 (GRCm38) M258V probably damaging Het
Osbpl7 A G 11: 97,055,934 (GRCm38) D211G probably damaging Het
Pcnx C T 12: 81,974,579 (GRCm38) probably benign Het
Plekhd1 G A 12: 80,706,436 (GRCm38) probably benign Het
Pnpla6 A G 8: 3,541,501 (GRCm38) E1165G probably damaging Het
Prkab2 T A 3: 97,662,317 (GRCm38) D66E probably benign Het
Prpsap2 A G 11: 61,741,000 (GRCm38) I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 (GRCm38) S885R possibly damaging Het
Rab26 A T 17: 24,530,045 (GRCm38) probably benign Het
Rab5a G A 17: 53,500,462 (GRCm38) M175I probably benign Het
Rassf9 T A 10: 102,545,649 (GRCm38) D297E probably benign Het
Rimbp2 C T 5: 128,803,861 (GRCm38) R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 (GRCm38) Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 (GRCm38) L263F probably benign Het
Sec14l1 T G 11: 117,149,140 (GRCm38) probably benign Het
Snrnp40 C G 4: 130,378,043 (GRCm38) probably null Het
Spaca1 T C 4: 34,044,267 (GRCm38) probably null Het
Stk36 C T 1: 74,612,730 (GRCm38) P394L probably benign Het
Stk4 T C 2: 164,096,800 (GRCm38) I196T probably damaging Het
Sult1b1 A T 5: 87,517,376 (GRCm38) M233K probably damaging Het
Tmem8b C T 4: 43,674,005 (GRCm38) T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 (GRCm38) F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 (GRCm38) T104P probably benign Het
Trmt2a G A 16: 18,249,703 (GRCm38) R80Q possibly damaging Het
Trps1 C A 15: 50,831,778 (GRCm38) E324* probably null Het
U2surp C T 9: 95,484,443 (GRCm38) V470I probably benign Het
Wdr18 G A 10: 79,967,502 (GRCm38) R400H probably benign Het
Wdr78 A G 4: 103,048,259 (GRCm38) V775A probably damaging Het
Zfp119b T A 17: 55,938,671 (GRCm38) H505L probably damaging Het
Zfp619 T A 7: 39,536,797 (GRCm38) C750* probably null Het
Zfr T C 15: 12,160,591 (GRCm38) I750T probably benign Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 126,144,325 (GRCm38) critical splice acceptor site probably null
IGL00970:Fam227b APN 2 126,127,060 (GRCm38) missense probably benign 0.01
IGL02040:Fam227b APN 2 126,121,084 (GRCm38) splice site probably benign
IGL02095:Fam227b APN 2 126,101,004 (GRCm38) missense probably damaging 0.97
IGL02352:Fam227b APN 2 126,146,254 (GRCm38) unclassified probably benign
IGL02359:Fam227b APN 2 126,146,254 (GRCm38) unclassified probably benign
IGL02506:Fam227b APN 2 126,003,911 (GRCm38) missense probably benign 0.22
IGL02717:Fam227b APN 2 126,003,843 (GRCm38) missense probably null 0.97
IGL02933:Fam227b APN 2 126,123,988 (GRCm38) splice site probably null
IGL03064:Fam227b APN 2 126,126,842 (GRCm38) splice site probably null
IGL03086:Fam227b APN 2 126,119,031 (GRCm38) missense probably benign 0.01
IGL03198:Fam227b APN 2 126,124,579 (GRCm38) critical splice donor site probably null
IGL03256:Fam227b APN 2 125,989,003 (GRCm38) missense probably damaging 0.99
IGL03368:Fam227b APN 2 126,119,063 (GRCm38) missense probably damaging 1.00
dana UTSW 2 126,116,123 (GRCm38) missense probably damaging 1.00
R0071:Fam227b UTSW 2 126,124,074 (GRCm38) missense probably benign 0.04
R0071:Fam227b UTSW 2 126,124,074 (GRCm38) missense probably benign 0.04
R0110:Fam227b UTSW 2 126,100,921 (GRCm38) missense probably damaging 1.00
R0140:Fam227b UTSW 2 126,124,603 (GRCm38) missense possibly damaging 0.53
R0499:Fam227b UTSW 2 126,100,909 (GRCm38) missense probably benign 0.25
R1240:Fam227b UTSW 2 126,124,585 (GRCm38) missense possibly damaging 0.56
R1356:Fam227b UTSW 2 126,119,008 (GRCm38) missense probably damaging 1.00
R1404:Fam227b UTSW 2 126,003,839 (GRCm38) missense probably damaging 0.99
R1404:Fam227b UTSW 2 126,003,839 (GRCm38) missense probably damaging 0.99
R2055:Fam227b UTSW 2 126,100,954 (GRCm38) missense probably benign 0.13
R2884:Fam227b UTSW 2 126,100,926 (GRCm38) missense probably benign 0.01
R3124:Fam227b UTSW 2 126,124,086 (GRCm38) missense probably benign 0.36
R3125:Fam227b UTSW 2 126,124,086 (GRCm38) missense probably benign 0.36
R3937:Fam227b UTSW 2 126,127,060 (GRCm38) missense probably benign 0.01
R4408:Fam227b UTSW 2 126,116,125 (GRCm38) missense possibly damaging 0.47
R4454:Fam227b UTSW 2 126,146,268 (GRCm38) unclassified probably benign
R4455:Fam227b UTSW 2 126,146,268 (GRCm38) unclassified probably benign
R4457:Fam227b UTSW 2 126,146,268 (GRCm38) unclassified probably benign
R4558:Fam227b UTSW 2 126,127,043 (GRCm38) missense probably benign 0.00
R4661:Fam227b UTSW 2 126,007,310 (GRCm38) missense probably damaging 0.99
R4809:Fam227b UTSW 2 126,116,125 (GRCm38) missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125,987,939 (GRCm38) missense probably benign 0.01
R4989:Fam227b UTSW 2 126,116,123 (GRCm38) missense probably damaging 1.00
R5011:Fam227b UTSW 2 126,116,123 (GRCm38) missense probably damaging 1.00
R5013:Fam227b UTSW 2 126,116,123 (GRCm38) missense probably damaging 1.00
R5014:Fam227b UTSW 2 126,116,123 (GRCm38) missense probably damaging 1.00
R5133:Fam227b UTSW 2 126,116,123 (GRCm38) missense probably damaging 1.00
R5184:Fam227b UTSW 2 126,116,123 (GRCm38) missense probably damaging 1.00
R5431:Fam227b UTSW 2 126,126,931 (GRCm38) missense probably benign 0.09
R5797:Fam227b UTSW 2 126,007,334 (GRCm38) missense probably benign
R6056:Fam227b UTSW 2 126,121,052 (GRCm38) missense probably damaging 1.00
R6218:Fam227b UTSW 2 126,126,962 (GRCm38) missense probably damaging 1.00
R6471:Fam227b UTSW 2 126,121,065 (GRCm38) missense probably damaging 1.00
R6660:Fam227b UTSW 2 126,144,307 (GRCm38) missense probably damaging 1.00
R6734:Fam227b UTSW 2 126,126,976 (GRCm38) nonsense probably null
R7136:Fam227b UTSW 2 126,124,028 (GRCm38) missense probably damaging 0.99
R7410:Fam227b UTSW 2 126,119,063 (GRCm38) missense probably damaging 1.00
R8417:Fam227b UTSW 2 126,121,062 (GRCm38) missense probably damaging 1.00
R8679:Fam227b UTSW 2 125,989,008 (GRCm38) missense probably benign 0.02
R8731:Fam227b UTSW 2 126,126,978 (GRCm38) missense possibly damaging 0.95
R8986:Fam227b UTSW 2 126,116,099 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATCAGGGCTCCAATACTGAGTGTC -3'
(R):5'- GTTTGAGTTTTCAGCAGCAGCATCC -3'

Sequencing Primer
(F):5'- TCAGGACAGAAATGTTACTCACA -3'
(R):5'- GTGGCTTGTCAAAATCTCTAGTTC -3'
Posted On 2013-04-24