Incidental Mutation 'R3949:Entpd7'
ID 307843
Institutional Source Beutler Lab
Gene Symbol Entpd7
Ensembl Gene ENSMUSG00000025192
Gene Name ectonucleoside triphosphate diphosphohydrolase 7
Synonyms 1810020C02Rik, 2810003F23Rik, 1810012B13Rik, LALP1, Lysal2
MMRRC Submission 040929-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R3949 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 43689672-43733697 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43691158 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 50 (R50Q)
Ref Sequence ENSEMBL: ENSMUSP00000079864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081079]
AlphaFold Q3TCT4
Predicted Effect probably benign
Transcript: ENSMUST00000081079
AA Change: R50Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192
AA Change: R50Q

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Pfam:GDA1_CD39 75 534 3.6e-106 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152786
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for deletions in this gene have increased Th17 T cell levels in the lamina propria of the small intestine. They show increased resistance to Citrobacter rodentium infection and increased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,570,419 M314L probably damaging Het
Apcs A G 1: 172,894,692 F29S probably damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Avl9 T C 6: 56,728,665 probably null Het
Ccdc130 A G 8: 84,258,824 V272A probably benign Het
Ccdc38 A G 10: 93,550,219 M66V probably damaging Het
Cfap46 T C 7: 139,678,551 K269E probably benign Het
Chrdl2 A C 7: 100,029,205 E328A possibly damaging Het
D430041D05Rik T C 2: 104,257,368 N421S probably benign Het
Dbndd1 G T 8: 123,506,734 Q207K probably benign Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fan1 C A 7: 64,371,544 E591* probably null Het
Fpr1 C A 17: 17,876,929 C266F probably benign Het
Gata4 C T 14: 63,240,697 R151H possibly damaging Het
Gipr T C 7: 19,157,429 N441S probably benign Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Ipo13 A G 4: 117,901,042 I708T probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Kctd8 C T 5: 69,341,274 G10S probably benign Het
Lamb1 A C 12: 31,282,649 K257Q probably damaging Het
Lcp1 A G 14: 75,206,129 N195S possibly damaging Het
Olfr1298 A T 2: 111,645,526 I157K possibly damaging Het
Olfr1480 T C 19: 13,530,020 S160P probably damaging Het
Paxbp1 T C 16: 91,044,017 D113G probably damaging Het
Pcdhb7 T C 18: 37,343,088 S426P probably benign Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Pld2 A G 11: 70,553,354 D492G probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrf1 A C 9: 89,981,744 probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Serpinb10 T A 1: 107,540,906 L170H probably damaging Het
Sfxn4 A G 19: 60,852,063 Y165H probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Slco5a1 A T 1: 12,989,609 V296D probably damaging Het
Syn2 T A 6: 115,227,329 probably null Het
Tbx2 C T 11: 85,838,275 Q495* probably null Het
Trav6-1 G A 14: 52,638,536 V8M probably benign Het
Usp7 A T 16: 8,716,564 N46K probably damaging Het
Vmn2r58 A T 7: 41,863,924 F432I probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Washc2 T C 6: 116,208,204 probably benign Het
Other mutations in Entpd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Entpd7 APN 19 43729839 missense probably benign 0.00
R0056:Entpd7 UTSW 19 43725294 missense probably benign 0.09
R0118:Entpd7 UTSW 19 43704312 nonsense probably null
R0639:Entpd7 UTSW 19 43691094 missense probably benign 0.42
R1479:Entpd7 UTSW 19 43721840 missense probably damaging 1.00
R1532:Entpd7 UTSW 19 43691077 missense possibly damaging 0.76
R1647:Entpd7 UTSW 19 43721745 splice site probably benign
R1689:Entpd7 UTSW 19 43725476 missense probably damaging 0.96
R2230:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2231:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2422:Entpd7 UTSW 19 43728088 missense possibly damaging 0.66
R3807:Entpd7 UTSW 19 43725540 critical splice donor site probably null
R3914:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4021:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4022:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4095:Entpd7 UTSW 19 43704201 missense probably damaging 1.00
R4737:Entpd7 UTSW 19 43691195 nonsense probably null
R5582:Entpd7 UTSW 19 43704994 missense probably damaging 1.00
R5653:Entpd7 UTSW 19 43691157 nonsense probably null
R5763:Entpd7 UTSW 19 43704266 missense probably damaging 1.00
R6508:Entpd7 UTSW 19 43691086 missense probably damaging 1.00
R7657:Entpd7 UTSW 19 43725467 missense possibly damaging 0.67
R8013:Entpd7 UTSW 19 43728055 missense probably benign 0.00
R8235:Entpd7 UTSW 19 43717545 missense probably damaging 1.00
R8880:Entpd7 UTSW 19 43704407 splice site probably benign
R9318:Entpd7 UTSW 19 43704270 missense possibly damaging 0.88
R9564:Entpd7 UTSW 19 43717450 missense probably benign 0.01
Z1176:Entpd7 UTSW 19 43725358 missense probably benign 0.43
Z1177:Entpd7 UTSW 19 43725497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTTCAGGGTGTTCATCTAG -3'
(R):5'- GGTGAGGACATAACTTAGTGACATG -3'

Sequencing Primer
(F):5'- AGCGGTAATTTATGGAGAGATTTTAG -3'
(R):5'- CTTAGTGACATGATGCTTACTGAG -3'
Posted On 2015-04-17