Mutagenetix > Incidental Mutations

Incidental Mutation 'R0377:Anapc1'

30785

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

038583-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0377 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 128641340 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

probably null
Transcript: ENSMUST00000014499

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110333

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Meta Mutation Damage Score

0.9594

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.8%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	C	A	11: 94,375,096	V107F	possibly damaging	Het
Acad11	T	A	9: 104,081,692		probably benign	Het
Ache	G	A	5: 137,290,928	E299K	possibly damaging	Het
Adam5	T	C	8: 24,747,541	T618A	probably benign	Het
Amigo2	T	A	15: 97,246,380	T54S	possibly damaging	Het
Armc4	G	A	18: 7,127,415	R933C	probably benign	Het
Btaf1	A	G	19: 36,989,002	K1057E	probably benign	Het
Cep55	T	A	19: 38,071,889	L396*	probably null	Het
Cic	C	A	7: 25,285,799	H1157N	probably damaging	Het
Cntnap5a	A	T	1: 116,292,529	T690S	probably benign	Het
D5Ertd579e	A	T	5: 36,604,567	C1319S	probably benign	Het
Dnah6	A	G	6: 73,121,992	S2027P	possibly damaging	Het
Dntt	G	A	19: 41,047,627	W369*	probably null	Het
Esp18	T	A	17: 39,409,944	W27R	probably benign	Het
Fam227b	A	T	2: 126,125,000		probably benign	Het
Fbxo31	G	A	8: 121,559,102		probably benign	Het
Gm13547	G	A	2: 29,761,791		probably null	Het
Gnl2	T	A	4: 125,046,382		probably benign	Het
Gpx2	G	A	12: 76,795,156	Q74*	probably null	Het
Gucy2c	A	G	6: 136,750,917		probably null	Het
Hoxa5	A	T	6: 52,202,646	W250R	probably damaging	Het
Izumo4	G	A	10: 80,702,840	R42H	probably damaging	Het
Kcnj12	G	A	11: 61,069,396	M71I	probably benign	Het
Kmt2b	A	T	7: 30,574,193	L2333Q	probably damaging	Het
Mak	T	C	13: 41,049,348	E177G	probably damaging	Het
Map3k7	T	A	4: 31,985,731	I218N	probably damaging	Het
Mark3	T	C	12: 111,629,029	L393P	probably damaging	Het
Msh4	A	G	3: 153,896,890	S234P	probably benign	Het
Mug1	A	G	6: 121,857,361	D367G	probably benign	Het
Mypn	A	G	10: 63,127,622		probably benign	Het
Ncapg	T	C	5: 45,693,817	V784A	probably benign	Het
Nutf2	T	A	8: 105,878,872	V113D	probably damaging	Het
Olfr1080	A	T	2: 86,553,583	D180E	probably damaging	Het
Opn3	T	C	1: 175,663,694	M258V	probably damaging	Het
Osbpl7	A	G	11: 97,055,934	D211G	probably damaging	Het
Pcnx	C	T	12: 81,974,579		probably benign	Het
Plekhd1	G	A	12: 80,706,436		probably benign	Het
Pnpla6	A	G	8: 3,541,501	E1165G	probably damaging	Het
Prkab2	T	A	3: 97,662,317	D66E	probably benign	Het
Prpsap2	A	G	11: 61,741,000	I177T	possibly damaging	Het
Ptpn23	A	T	9: 110,388,132	S885R	possibly damaging	Het
Rab26	A	T	17: 24,530,045		probably benign	Het
Rab5a	G	A	17: 53,500,462	M175I	probably benign	Het
Rassf9	T	A	10: 102,545,649	D297E	probably benign	Het
Rimbp2	C	T	5: 128,803,861	R161Q	probably damaging	Het
Rtp1	A	G	16: 23,431,284	Y133C	probably damaging	Het
Sdr16c5	G	A	4: 4,005,546	L263F	probably benign	Het
Sec14l1	T	G	11: 117,149,140		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spaca1	T	C	4: 34,044,267		probably null	Het
Stk36	C	T	1: 74,612,730	P394L	probably benign	Het
Stk4	T	C	2: 164,096,800	I196T	probably damaging	Het
Sult1b1	A	T	5: 87,517,376	M233K	probably damaging	Het
Tmem8b	C	T	4: 43,674,005	T212M	probably damaging	Het
Tmprss11g	A	T	5: 86,490,751	F293I	probably damaging	Het
Tnfsf11	T	G	14: 78,299,912	T104P	probably benign	Het
Trmt2a	G	A	16: 18,249,703	R80Q	possibly damaging	Het
Trps1	C	A	15: 50,831,778	E324*	probably null	Het
U2surp	C	T	9: 95,484,443	V470I	probably benign	Het
Wdr18	G	A	10: 79,967,502	R400H	probably benign	Het
Wdr78	A	G	4: 103,048,259	V775A	probably damaging	Het
Zfp119b	T	A	17: 55,938,671	H505L	probably damaging	Het
Zfp619	T	A	7: 39,536,797	C750*	probably null	Het
Zfr	T	C	15: 12,160,591	I750T	probably benign	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AGTGTAGGCCACTGCTAGACACTG -3'
(R):5'- CATGTCAATTACCCGGCTCCTCAG -3'

Sequencing Primer
(F):5'- CTAGACACTGCCTGGTGTGAG -3'
(R):5'- GGCTCCTCAGCATTCACG -3'

Posted On

2013-04-24