Incidental Mutation 'R3950:Olfr1128'
ID307850
Institutional Source Beutler Lab
Gene Symbol Olfr1128
Ensembl Gene ENSMUSG00000075156
Gene Nameolfactory receptor 1128
SynonymsGA_x6K02T2Q125-49048592-49047657, MOR176-3
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3950 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87544607-87545542 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87545065 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 160 (T160A)
Ref Sequence ENSEMBL: ENSMUSP00000099684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102624]
Predicted Effect probably damaging
Transcript: ENSMUST00000102624
AA Change: T160A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099684
Gene: ENSMUSG00000075156
AA Change: T160A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.3e-46 PFAM
Pfam:7tm_1 41 290 3.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120590
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Olfr1128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Olfr1128 APN 2 87545103 missense probably benign 0.00
IGL02638:Olfr1128 APN 2 87544749 missense probably damaging 1.00
IGL02749:Olfr1128 APN 2 87544657 missense probably damaging 1.00
R1650:Olfr1128 UTSW 2 87545428 missense probably benign 0.01
R1789:Olfr1128 UTSW 2 87544983 missense probably damaging 1.00
R2100:Olfr1128 UTSW 2 87544825 missense probably damaging 1.00
R2163:Olfr1128 UTSW 2 87544894 missense probably damaging 1.00
R3951:Olfr1128 UTSW 2 87545065 missense probably damaging 1.00
R3952:Olfr1128 UTSW 2 87545065 missense probably damaging 1.00
R6185:Olfr1128 UTSW 2 87544743 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCAGATGGTCGCAATGATGTAG -3'
(R):5'- GGATTCCTTGCAATTTATGTGCTC -3'

Sequencing Primer
(F):5'- TGGTCGCAATGATGTAGCAGTAG -3'
(R):5'- CTTGCAATTTATGTGCTCTTCAGATG -3'
Posted On2015-04-17