Incidental Mutation 'R3950:Pdhx'
ID 307851
Institutional Source Beutler Lab
Gene Symbol Pdhx
Ensembl Gene ENSMUSG00000010914
Gene Name pyruvate dehydrogenase complex, component X
Synonyms Pdx1
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3950 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 103021075-103073513 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103035241 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 199 (S199P)
Ref Sequence ENSEMBL: ENSMUSP00000119172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011058] [ENSMUST00000111183] [ENSMUST00000132449]
AlphaFold Q8BKZ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000011058
AA Change: S264P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000011058
Gene: ENSMUSG00000010914
AA Change: S264P

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Biotin_lipoyl 57 131 1.3e-21 PFAM
low complexity region 148 172 N/A INTRINSIC
Pfam:E3_binding 182 217 5e-9 PFAM
low complexity region 233 249 N/A INTRINSIC
Pfam:2-oxoacid_dh 272 501 8.4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111183
SMART Domains Protein: ENSMUSP00000106814
Gene: ENSMUSG00000010914

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Biotin_lipoyl 57 131 1.8e-21 PFAM
low complexity region 148 172 N/A INTRINSIC
Pfam:E3_binding 180 216 6.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132449
AA Change: S199P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119172
Gene: ENSMUSG00000010914
AA Change: S199P

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 5 66 1.3e-14 PFAM
low complexity region 83 107 N/A INTRINSIC
Pfam:E3_binding 115 153 6.1e-14 PFAM
low complexity region 168 184 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Pdhx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Pdhx APN 2 103030341 unclassified probably benign
IGL02450:Pdhx APN 2 103042249 missense probably benign 0.00
R0152:Pdhx UTSW 2 103028280 missense probably benign 0.04
R0317:Pdhx UTSW 2 103028280 missense probably benign 0.04
R2351:Pdhx UTSW 2 103024217 nonsense probably null
R3937:Pdhx UTSW 2 103022219 missense probably damaging 1.00
R4546:Pdhx UTSW 2 103073397 missense probably null 0.99
R4677:Pdhx UTSW 2 103073466 splice site probably null
R4744:Pdhx UTSW 2 103042296 missense probably benign 0.01
R4996:Pdhx UTSW 2 103030312 missense probably damaging 1.00
R5000:Pdhx UTSW 2 103041040 splice site probably null
R5076:Pdhx UTSW 2 103041077 missense probably damaging 0.99
R5682:Pdhx UTSW 2 103035340 missense probably benign 0.00
R6246:Pdhx UTSW 2 103046792 missense probably damaging 1.00
R6850:Pdhx UTSW 2 103041100 missense probably damaging 1.00
R7141:Pdhx UTSW 2 103073314 missense probably benign 0.21
R7219:Pdhx UTSW 2 103028415 missense probably benign 0.01
R7460:Pdhx UTSW 2 103046779 missense probably damaging 1.00
R7552:Pdhx UTSW 2 103046754 missense probably benign 0.01
R8325:Pdhx UTSW 2 103042252 missense probably benign 0.08
R9163:Pdhx UTSW 2 103022216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTAAGCTCTGGTTAACATGG -3'
(R):5'- GCTGCATGGTTACCCAGTTTC -3'

Sequencing Primer
(F):5'- AAGCCATGGAGGGATGTTCCTTAC -3'
(R):5'- AGTTTCCTTTCATTTCCAGAGATG -3'
Posted On 2015-04-17