Incidental Mutation 'R3950:Tmem127'
ID 307852
Institutional Source Beutler Lab
Gene Symbol Tmem127
Ensembl Gene ENSMUSG00000034850
Gene Name transmembrane protein 127
Synonyms 2310003P10Rik
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3950 (G1)
Quality Score 172
Status Not validated
Chromosome 2
Chromosomal Location 127247908-127261107 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127248657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 31 (L31P)
Ref Sequence ENSEMBL: ENSMUSP00000133701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003759] [ENSMUST00000035871] [ENSMUST00000172636] [ENSMUST00000174030] [ENSMUST00000174288] [ENSMUST00000174503] [ENSMUST00000174863]
AlphaFold Q8BGP5
Predicted Effect probably benign
Transcript: ENSMUST00000003759
SMART Domains Protein: ENSMUSP00000003759
Gene: ENSMUSG00000003662

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 178 6.04e-8 SMART
WD40 183 222 9.22e-13 SMART
WD40 240 280 8.04e-4 SMART
WD40 291 332 5.26e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000035871
AA Change: L31P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035434
Gene: ENSMUSG00000034850
AA Change: L31P

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 179 3e-98 BLAST
low complexity region 202 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143575
Predicted Effect probably benign
Transcript: ENSMUST00000172636
SMART Domains Protein: ENSMUSP00000134199
Gene: ENSMUSG00000003662

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174030
SMART Domains Protein: ENSMUSP00000134189
Gene: ENSMUSG00000003662

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 178 6.04e-8 SMART
WD40 183 222 9.22e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174288
SMART Domains Protein: ENSMUSP00000134629
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
Blast:Sec63 1 95 1e-60 BLAST
low complexity region 118 132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174503
AA Change: L31P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133701
Gene: ENSMUSG00000034850
AA Change: L31P

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 124 8e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174863
SMART Domains Protein: ENSMUSP00000134159
Gene: ENSMUSG00000003662

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 176 1.38e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein with 3 predicted transmembrane domains. The protein is associated with a subpopulation of vesicular organelles corresponding to early endosomal structures, with the Golgi, and with lysosomes, and may participate in protein trafficking between these structures. Mutations in this gene and several other genes cause pheochromocytomas. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Aug 2010]
PHENOTYPE: Lysosomal activity and endosomal fusion mediated by Rab5 were affected in mouse embryonic fibroblasts of homozygous null mutants [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Tmem127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Tmem127 APN 2 127257086 missense probably damaging 1.00
IGL02108:Tmem127 APN 2 127257106 missense probably damaging 0.98
IGL02556:Tmem127 APN 2 127256002 splice site probably null
R0070:Tmem127 UTSW 2 127257059 missense probably damaging 1.00
R0070:Tmem127 UTSW 2 127257059 missense probably damaging 1.00
R0765:Tmem127 UTSW 2 127257149 missense probably damaging 0.96
R1696:Tmem127 UTSW 2 127248707 missense probably damaging 0.98
R1827:Tmem127 UTSW 2 127256174 splice site probably null
R1828:Tmem127 UTSW 2 127256174 splice site probably null
R3498:Tmem127 UTSW 2 127256120 missense probably benign 0.27
R3684:Tmem127 UTSW 2 127248732 missense possibly damaging 0.72
R5337:Tmem127 UTSW 2 127256145 missense probably damaging 0.98
R8831:Tmem127 UTSW 2 127257059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCCTTTGGTCTGTGCTCAG -3'
(R):5'- AGCCAGCCTCATATCTGTTCTG -3'

Sequencing Primer
(F):5'- GTTGCTCTCCACCTGGGTACAG -3'
(R):5'- CCTCAAGCCAAGAGAGCAGG -3'
Posted On 2015-04-17