Incidental Mutation 'R3950:Ninl'
ID 307853
Institutional Source Beutler Lab
Gene Symbol Ninl
Ensembl Gene ENSMUSG00000068115
Gene Name ninein-like
Synonyms LOC381387, LOC381388, 4930519N13Rik
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3950 (G1)
Quality Score 218
Status Not validated
Chromosome 2
Chromosomal Location 150934519-151039382 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 150952488 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 740 (I740K)
Ref Sequence ENSEMBL: ENSMUSP00000105522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109896] [ENSMUST00000124135]
AlphaFold Q6ZQ12
Predicted Effect possibly damaging
Transcript: ENSMUST00000109896
AA Change: I740K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115
AA Change: I740K

DomainStartEndE-ValueType
EFh 12 40 6.56e0 SMART
low complexity region 76 93 N/A INTRINSIC
EFh 201 229 4.45e1 SMART
EFh 238 266 8.98e-4 SMART
low complexity region 295 306 N/A INTRINSIC
coiled coil region 381 423 N/A INTRINSIC
coiled coil region 461 517 N/A INTRINSIC
coiled coil region 541 584 N/A INTRINSIC
coiled coil region 620 699 N/A INTRINSIC
coiled coil region 728 751 N/A INTRINSIC
coiled coil region 835 863 N/A INTRINSIC
coiled coil region 1058 1334 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124135
AA Change: I102K
SMART Domains Protein: ENSMUSP00000122069
Gene: ENSMUSG00000068115
AA Change: I102K

DomainStartEndE-ValueType
coiled coil region 16 61 N/A INTRINSIC
coiled coil region 92 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147293
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit bone-marrow myeloid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Ninl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ninl APN 2 150966241 missense probably damaging 0.98
IGL01697:Ninl APN 2 150939947 missense probably damaging 1.00
IGL01756:Ninl APN 2 150979516 missense probably damaging 1.00
IGL01925:Ninl APN 2 150971059 missense probably damaging 1.00
IGL02341:Ninl APN 2 150944605 nonsense probably null
IGL02838:Ninl APN 2 150955711 splice site probably null
IGL02868:Ninl APN 2 150937054 missense probably benign
IGL03116:Ninl APN 2 150964219 missense probably damaging 1.00
IGL03396:Ninl APN 2 150966212 missense possibly damaging 0.88
R0117:Ninl UTSW 2 150937673 missense probably damaging 0.98
R0685:Ninl UTSW 2 150939855 missense possibly damaging 0.73
R0928:Ninl UTSW 2 150963475 missense probably damaging 0.99
R1051:Ninl UTSW 2 150970126 missense probably damaging 1.00
R1441:Ninl UTSW 2 150971124 missense probably benign 0.10
R1493:Ninl UTSW 2 150980095 missense probably damaging 1.00
R1499:Ninl UTSW 2 150980176 missense possibly damaging 0.70
R1539:Ninl UTSW 2 150975947 missense probably damaging 1.00
R1658:Ninl UTSW 2 150964159 missense probably damaging 1.00
R2038:Ninl UTSW 2 150975843 nonsense probably null
R2156:Ninl UTSW 2 150944583 missense probably damaging 1.00
R2232:Ninl UTSW 2 150950050 missense probably benign 0.00
R2373:Ninl UTSW 2 150980117 missense probably damaging 1.00
R3743:Ninl UTSW 2 150950248 missense probably benign 0.01
R3906:Ninl UTSW 2 150980119 missense probably damaging 1.00
R4283:Ninl UTSW 2 150953416 unclassified probably benign
R4798:Ninl UTSW 2 150959881 nonsense probably null
R4963:Ninl UTSW 2 150939909 missense probably benign 0.04
R4998:Ninl UTSW 2 150953364 missense probably damaging 1.00
R5343:Ninl UTSW 2 150971190 missense probably benign 0.01
R5810:Ninl UTSW 2 150950168 missense probably benign 0.31
R5825:Ninl UTSW 2 150940724 missense probably damaging 1.00
R6436:Ninl UTSW 2 150966178 missense probably damaging 1.00
R6728:Ninl UTSW 2 150975857 nonsense probably null
R6734:Ninl UTSW 2 150945083 critical splice donor site probably null
R6997:Ninl UTSW 2 150966225 missense probably benign 0.08
R7135:Ninl UTSW 2 150955604 missense probably benign 0.00
R7157:Ninl UTSW 2 150949343 missense possibly damaging 0.63
R7315:Ninl UTSW 2 150950050 missense probably benign 0.00
R7840:Ninl UTSW 2 150966096 missense probably benign 0.00
R8134:Ninl UTSW 2 150950314 missense probably benign 0.01
R8319:Ninl UTSW 2 150959907 missense probably damaging 1.00
R8802:Ninl UTSW 2 150935252 missense probably damaging 1.00
R8997:Ninl UTSW 2 150959896 missense probably damaging 0.98
R9231:Ninl UTSW 2 150950209 missense probably benign
X0062:Ninl UTSW 2 150970046 missense probably damaging 1.00
Z1177:Ninl UTSW 2 150953398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCTTGCAACCAGGCAGTGAG -3'
(R):5'- TGTATGCCAAGTCGCAGGAG -3'

Sequencing Primer
(F):5'- AAACTACTCCATGGCCCAGTGTG -3'
(R):5'- CAAGTCGCAGGAGGTCATC -3'
Posted On 2015-04-17