Incidental Mutation 'R3950:Pard6b'
ID 307855
Institutional Source Beutler Lab
Gene Symbol Pard6b
Ensembl Gene ENSMUSG00000044641
Gene Name par-6 family cell polarity regulator beta
Synonyms
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R3950 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 168081004-168101203 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 168099194 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 367 (T367I)
Ref Sequence ENSEMBL: ENSMUSP00000052619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052125]
AlphaFold Q9JK83
PDB Structure Structure of Cdc42 in a complex with the GTPase-binding domain of the cell polarity protein, Par6 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000052125
AA Change: T367I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052619
Gene: ENSMUSG00000044641
AA Change: T367I

DomainStartEndE-ValueType
PB1 16 96 3.88e-18 SMART
PDZ 167 250 7.48e-14 SMART
low complexity region 287 301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the PAR6 family and encodes a protein with a PSD95/Discs-large/ZO1 (PDZ) domain, an OPR domain and a semi-Cdc42/Rac interactive binding (CRIB) domain. This cytoplasmic protein is involved in asymmetrical cell division and cell polarization processes as a member of a multi-protein complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Pard6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Pard6b APN 2 168087378 missense probably benign 0.00
IGL02648:Pard6b APN 2 168098927 missense probably benign 0.17
R0462:Pard6b UTSW 2 168087547 missense possibly damaging 0.94
R1807:Pard6b UTSW 2 168087412 missense probably damaging 1.00
R3616:Pard6b UTSW 2 168087339 splice site probably benign
R4211:Pard6b UTSW 2 168099023 missense probably benign 0.04
R4776:Pard6b UTSW 2 168098788 missense probably damaging 1.00
R5687:Pard6b UTSW 2 168098626 missense probably damaging 1.00
R6053:Pard6b UTSW 2 168099053 missense possibly damaging 0.77
Z1177:Pard6b UTSW 2 168098583 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTGAAGACAGTGGCGAGCC -3'
(R):5'- TCTCAGTTTCAGAGCAGCAG -3'

Sequencing Primer
(F):5'- CGCAGCAGATCCCGAAG -3'
(R):5'- TTTCAGAGCAGCAGCACCTG -3'
Posted On 2015-04-17