Incidental Mutation 'R3950:Hsd3b1'
ID307857
Institutional Source Beutler Lab
Gene Symbol Hsd3b1
Ensembl Gene ENSMUSG00000027871
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
SynonymsD3Ertd383e
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R3950 (G1)
Quality Score116
Status Not validated
Chromosome3
Chromosomal Location98852194-98859794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98856138 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 56 (V56M)
Ref Sequence ENSEMBL: ENSMUSP00000102630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029465] [ENSMUST00000107016]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029465
AA Change: V56M

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029465
Gene: ENSMUSG00000027871
AA Change: V56M

DomainStartEndE-ValueType
Pfam:Epimerase 24 248 3.8e-23 PFAM
Pfam:NAD_binding_4 25 226 3.4e-18 PFAM
Pfam:Polysacc_synt_2 30 129 1.3e-8 PFAM
Pfam:3Beta_HSD 34 282 1.8e-102 PFAM
Pfam:NAD_binding_10 35 228 1.7e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107016
AA Change: V56M

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102630
Gene: ENSMUSG00000027871
AA Change: V56M

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 264 4.3e-8 PFAM
Pfam:KR 5 133 1.1e-7 PFAM
Pfam:Ldh_1_N 5 135 4.3e-7 PFAM
Pfam:Polysacc_synt_2 6 136 3e-14 PFAM
Pfam:NmrA 6 138 6.2e-10 PFAM
Pfam:Epimerase 6 250 2.9e-30 PFAM
Pfam:GDP_Man_Dehyd 7 216 6.6e-16 PFAM
Pfam:3Beta_HSD 7 288 2.1e-122 PFAM
Pfam:NAD_binding_4 8 219 4e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that catalyzes the oxidative conversion of delta(5)-ene-3-beta-hydroxy steroid, and the oxidative conversion of ketosteroids. It plays a crucial role in the biosynthesis of all classes of hormonal steroids. This gene is predominantly expressed in the adrenals and the gonads. Mutations in this gene are associated with 3-beta-hydroxysteroid dehydrogenase, type II, deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Hsd3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Hsd3b1 APN 3 98853246 missense probably damaging 1.00
IGL01955:Hsd3b1 APN 3 98853147 missense probably benign 0.08
IGL02894:Hsd3b1 APN 3 98852929 missense possibly damaging 0.88
IGL03136:Hsd3b1 APN 3 98852985 missense probably damaging 1.00
R0265:Hsd3b1 UTSW 3 98852773 missense probably damaging 1.00
R0326:Hsd3b1 UTSW 3 98853274 missense probably damaging 1.00
R0390:Hsd3b1 UTSW 3 98853039 missense probably damaging 1.00
R1532:Hsd3b1 UTSW 3 98852898 missense probably damaging 1.00
R2845:Hsd3b1 UTSW 3 98852778 missense probably damaging 1.00
R2846:Hsd3b1 UTSW 3 98852778 missense probably damaging 1.00
R2898:Hsd3b1 UTSW 3 98853307 missense probably benign 0.00
R3153:Hsd3b1 UTSW 3 98852664 missense probably damaging 0.99
R4456:Hsd3b1 UTSW 3 98856143 missense probably benign 0.01
R4792:Hsd3b1 UTSW 3 98852910 missense probably benign 0.22
R4799:Hsd3b1 UTSW 3 98852865 missense probably benign 0.07
R4898:Hsd3b1 UTSW 3 98853326 missense probably benign 0.12
R5512:Hsd3b1 UTSW 3 98853205 missense probably benign 0.06
R5834:Hsd3b1 UTSW 3 98852939 missense possibly damaging 0.60
R5921:Hsd3b1 UTSW 3 98857899 missense probably benign 0.06
R6221:Hsd3b1 UTSW 3 98853156 missense probably benign 0.00
R6918:Hsd3b1 UTSW 3 98853109 missense probably damaging 0.98
R7058:Hsd3b1 UTSW 3 98857815 splice site probably null
R7242:Hsd3b1 UTSW 3 98853210 missense probably damaging 1.00
R8181:Hsd3b1 UTSW 3 98856137 missense probably damaging 1.00
R8187:Hsd3b1 UTSW 3 98852617 missense probably damaging 1.00
R8237:Hsd3b1 UTSW 3 98853110 missense possibly damaging 0.65
Z1176:Hsd3b1 UTSW 3 98852886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGCTCCATACTTTCCCAG -3'
(R):5'- ACTGCTCAGATGCATTTTGTAC -3'

Sequencing Primer
(F):5'- GGTACTGTACCTTTCAGATTGACATC -3'
(R):5'- GCTCAGATGCATTTTGTACAAAGGG -3'
Posted On2015-04-17