Mutagenetix > Incidental Mutation

Incidental Mutation 'R3950:Col11a1'

307858

Institutional Source

Beutler Lab

Gene Symbol

Col11a1

Ensembl Gene

ENSMUSG00000027966

Gene Name

collagen, type XI, alpha 1

Synonyms

C530001D20Rik

MMRRC Submission

040930-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.897) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114030540-114220718 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 114121445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000089793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092155]

AlphaFold

Q61245

Predicted Effect

probably null
Transcript: ENSMUST00000092155

SMART Domains

Protein: ENSMUSP00000089793
Gene: ENSMUSG00000027966

Domain	Start	End	E-Value	Type
TSPN	37	228	1.83e-62	SMART
LamG	96	227	5.87e-11	SMART
low complexity region	256	276	N/A	INTRINSIC
internal_repeat_4	357	431	3.12e-6	PROSPERO
Pfam:Collagen	433	491	2.6e-9	PFAM
Pfam:Collagen	525	586	5.9e-9	PFAM
low complexity region	611	632	N/A	INTRINSIC
low complexity region	638	677	N/A	INTRINSIC
Pfam:Collagen	721	805	3.6e-8	PFAM
internal_repeat_3	814	854	3.55e-9	PROSPERO
internal_repeat_1	818	869	2.01e-16	PROSPERO
low complexity region	872	944	N/A	INTRINSIC
low complexity region	952	1001	N/A	INTRINSIC
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1066	1100	N/A	INTRINSIC
low complexity region	1103	1121	N/A	INTRINSIC
internal_repeat_2	1124	1188	2.4e-12	PROSPERO
low complexity region	1189	1205	N/A	INTRINSIC
low complexity region	1211	1232	N/A	INTRINSIC
low complexity region	1235	1250	N/A	INTRINSIC
low complexity region	1252	1368	N/A	INTRINSIC
low complexity region	1373	1392	N/A	INTRINSIC
low complexity region	1417	1448	N/A	INTRINSIC
low complexity region	1453	1463	N/A	INTRINSIC
Pfam:Collagen	1481	1543	8.3e-9	PFAM
COLFI	1574	1803	7.28e-127	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XI collagen, one of the low abundance fibrillar collagens that is essential for normal embryonic skeletal development and the cohesive properties of cartilage. The encoded protein, in association with the alpha-1 subunit of type II collagen, forms a heterotrimeric type XI procollagen that undergoes proteolytic processing. Mice lacking the encoded protein develop severe chondrodysplasia and die at birth. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality by asphyxia. Mutants animals display weak tracheal cartilage, short snout, short mandible, cleft palate, short limbs, and externally rotated distal portion of the hindlimbs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Ahnak2	A	T	12: 112,785,789	I186N	probably damaging	Het
Appbp2	A	G	11: 85,194,706	I458T	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
B4galt4	G	T	16: 38,768,022	A72S	probably benign	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm2a	A	G	19: 4,343,232	L365S	possibly damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Klhl18	T	A	9: 110,428,902	Y490F	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Pif1	C	A	9: 65,591,834	N445K	probably damaging	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Ttc6	A	G	12: 57,649,506	Y31C	probably damaging	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zbtb38	A	G	9: 96,687,546	F495S	probably damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het
Zswim9	T	A	7: 13,261,577	T218S	possibly damaging	Het

Other mutations in Col11a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Col11a1	APN	3	114066533	missense	unknown
IGL00578:Col11a1	APN	3	114194106	missense	possibly damaging	0.95
IGL00742:Col11a1	APN	3	114124315	missense	unknown
IGL01014:Col11a1	APN	3	114123809	splice site	probably benign
IGL01099:Col11a1	APN	3	114112041	nonsense	probably null
IGL01129:Col11a1	APN	3	114185873	splice site	probably benign
IGL01474:Col11a1	APN	3	114217134	utr 3 prime	probably benign
IGL01884:Col11a1	APN	3	114066542	missense	unknown
IGL02104:Col11a1	APN	3	114181397	critical splice donor site	probably null
IGL02715:Col11a1	APN	3	114129409	missense	probably benign	0.06
IGL02978:Col11a1	APN	3	114061562	missense	unknown
IGL03203:Col11a1	APN	3	114212084	missense	possibly damaging	0.91
IGL03240:Col11a1	APN	3	114217210	splice site	probably null
IGL03357:Col11a1	APN	3	114194091	missense	probably damaging	1.00
IGL03390:Col11a1	APN	3	114090253	missense	unknown
gluon	UTSW	3	114217170	utr 3 prime	probably benign
uncovered	UTSW	3	114112467	unclassified	probably benign
weakforce	UTSW	3	114113600	missense	unknown
R0110:Col11a1	UTSW	3	114105456	splice site	probably benign
R0144:Col11a1	UTSW	3	114113594	missense	unknown
R0432:Col11a1	UTSW	3	114205901	splice site	probably benign
R0468:Col11a1	UTSW	3	114217058	utr 3 prime	probably benign
R0510:Col11a1	UTSW	3	114105456	splice site	probably benign
R0535:Col11a1	UTSW	3	114061535	missense	unknown
R0608:Col11a1	UTSW	3	114218715	utr 3 prime	probably benign
R0826:Col11a1	UTSW	3	114138765	missense	unknown
R0827:Col11a1	UTSW	3	114138765	missense	unknown
R0862:Col11a1	UTSW	3	114138765	missense	unknown
R0863:Col11a1	UTSW	3	114138765	missense	unknown
R0926:Col11a1	UTSW	3	114090180	missense	unknown
R0980:Col11a1	UTSW	3	114138765	missense	unknown
R0981:Col11a1	UTSW	3	114138765	missense	unknown
R1004:Col11a1	UTSW	3	114095022	splice site	probably benign
R1037:Col11a1	UTSW	3	114194152	missense	probably damaging	1.00
R1171:Col11a1	UTSW	3	114066564	missense	unknown
R1316:Col11a1	UTSW	3	114138970	splice site	probably null
R1324:Col11a1	UTSW	3	114030916	missense	unknown
R1338:Col11a1	UTSW	3	114216995	utr 3 prime	probably benign
R1513:Col11a1	UTSW	3	114097154	missense	unknown
R1528:Col11a1	UTSW	3	114216995	utr 3 prime	probably benign
R1567:Col11a1	UTSW	3	114138612	missense	unknown
R1596:Col11a1	UTSW	3	114152613	utr 3 prime	probably benign
R1605:Col11a1	UTSW	3	114131641	missense	probably damaging	1.00
R1624:Col11a1	UTSW	3	114158155	missense	probably damaging	0.97
R1626:Col11a1	UTSW	3	114131569	missense	probably damaging	1.00
R1666:Col11a1	UTSW	3	114061535	missense	unknown
R1806:Col11a1	UTSW	3	114158142	missense	probably damaging	1.00
R2001:Col11a1	UTSW	3	114165293	splice site	probably null
R2084:Col11a1	UTSW	3	114158142	missense	probably damaging	1.00
R2085:Col11a1	UTSW	3	114158142	missense	probably damaging	1.00
R3926:Col11a1	UTSW	3	114090124	splice site	probably benign
R3970:Col11a1	UTSW	3	114097189	missense	unknown
R4171:Col11a1	UTSW	3	114208214	missense	probably damaging	0.99
R4175:Col11a1	UTSW	3	114208223	missense	possibly damaging	0.83
R4176:Col11a1	UTSW	3	114208223	missense	possibly damaging	0.83
R4413:Col11a1	UTSW	3	114108316	missense	unknown
R4540:Col11a1	UTSW	3	114097166	missense	unknown
R5210:Col11a1	UTSW	3	114153157	missense	probably damaging	1.00
R5250:Col11a1	UTSW	3	114217170	utr 3 prime	probably benign
R5335:Col11a1	UTSW	3	114095240	missense	unknown
R5344:Col11a1	UTSW	3	114208362	critical splice donor site	probably null
R5394:Col11a1	UTSW	3	114194184	splice site	probably null
R5687:Col11a1	UTSW	3	114217103	utr 3 prime	probably benign
R5708:Col11a1	UTSW	3	114097094	missense	unknown
R5763:Col11a1	UTSW	3	114094596	intron	probably benign
R5792:Col11a1	UTSW	3	114131593	missense	probably damaging	1.00
R6259:Col11a1	UTSW	3	114138447	missense	probably benign
R6679:Col11a1	UTSW	3	114152719	splice site	probably null
R6738:Col11a1	UTSW	3	114112467	unclassified	probably benign
R6747:Col11a1	UTSW	3	114212450	nonsense	probably null
R6808:Col11a1	UTSW	3	114094944	missense	possibly damaging	0.87
R6861:Col11a1	UTSW	3	114167492	missense	probably damaging	1.00
R7201:Col11a1	UTSW	3	114090157	missense	unknown
R7264:Col11a1	UTSW	3	114185599	missense	unknown
R7393:Col11a1	UTSW	3	114097106	missense	unknown
R7445:Col11a1	UTSW	3	114193929	missense	unknown
R7479:Col11a1	UTSW	3	114102569	missense	unknown
R7548:Col11a1	UTSW	3	114123760	missense	unknown
R7683:Col11a1	UTSW	3	114113736	missense	unknown
R7747:Col11a1	UTSW	3	114102572	missense	unknown
R7809:Col11a1	UTSW	3	114097186	missense	unknown
R7951:Col11a1	UTSW	3	114095215	missense	unknown
R8057:Col11a1	UTSW	3	114131614	missense	unknown
R8134:Col11a1	UTSW	3	114218786	missense	unknown
R8139:Col11a1	UTSW	3	114097049	missense	unknown
R8243:Col11a1	UTSW	3	114061492	missense	unknown
R8324:Col11a1	UTSW	3	114164410	missense	probably damaging	1.00
R8346:Col11a1	UTSW	3	114212169	missense	unknown
R8480:Col11a1	UTSW	3	114181394	missense	probably benign	0.04
R9113:Col11a1	UTSW	3	114094543	nonsense	probably null
R9122:Col11a1	UTSW	3	114113600	missense	unknown
R9137:Col11a1	UTSW	3	114061523	missense	unknown
R9224:Col11a1	UTSW	3	114208280	missense	unknown
R9264:Col11a1	UTSW	3	114212160	missense	unknown
R9272:Col11a1	UTSW	3	114108299	nonsense	probably null
R9382:Col11a1	UTSW	3	114105397	missense	unknown
R9492:Col11a1	UTSW	3	114212103	missense	probably benign	0.39
RF002:Col11a1	UTSW	3	114217001	missense	unknown
X0018:Col11a1	UTSW	3	114112233	unclassified	probably benign
Z1177:Col11a1	UTSW	3	114138921	missense	unknown
Z1177:Col11a1	UTSW	3	114165235	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGAAGACACACTCTCAAGTC -3'
(R):5'- AAGTTCTGCTATGCAAGATGTGG -3'

Sequencing Primer
(F):5'- CTCAAGTCCATGCTGTTATTAGTG -3'
(R):5'- GCTTGAAGCTTCCCAACAAATGAG -3'

Posted On

2015-04-17