Mutagenetix > Incidental Mutations

Incidental Mutation 'R3950:Zswim9'

307864

Institutional Source

Beutler Lab

Gene Symbol

Zswim9

Ensembl Gene

ENSMUSG00000070814

Gene Name

zinc finger SWIM-type containing 9

Synonyms

6330408A02Rik

MMRRC Submission

040930-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13258967-13278721 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 13261577 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 218 (T218S)

Ref Sequence

ENSEMBL: ENSMUSP00000104172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108532] [ENSMUST00000119139] [ENSMUST00000119558]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108532
AA Change: T218S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000104172
Gene: ENSMUSG00000070814
AA Change: T218S

Domain	Start	End	E-Value	Type
low complexity region	213	224	N/A	INTRINSIC
low complexity region	405	423	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119139
AA Change: T218S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112652
Gene: ENSMUSG00000070814
AA Change: T218S

Domain	Start	End	E-Value	Type
low complexity region	213	224	N/A	INTRINSIC
low complexity region	405	423	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119558

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Ahnak2	A	T	12: 112,785,789	I186N	probably damaging	Het
Appbp2	A	G	11: 85,194,706	I458T	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
B4galt4	G	T	16: 38,768,022	A72S	probably benign	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col11a1	T	C	3: 114,121,445		probably null	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm2a	A	G	19: 4,343,232	L365S	possibly damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Klhl18	T	A	9: 110,428,902	Y490F	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Pif1	C	A	9: 65,591,834	N445K	probably damaging	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Ttc6	A	G	12: 57,649,506	Y31C	probably damaging	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zbtb38	A	G	9: 96,687,546	F495S	probably damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het

Other mutations in Zswim9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01926:Zswim9	APN	7	13260321	missense	possibly damaging	0.53
IGL02063:Zswim9	APN	7	13260681	missense	probably damaging	0.98
R0568:Zswim9	UTSW	7	13261026	missense	probably damaging	0.99
R0680:Zswim9	UTSW	7	13260321	missense	probably benign	0.10
R1438:Zswim9	UTSW	7	13277218	missense	possibly damaging	0.86
R1600:Zswim9	UTSW	7	13269571	missense	probably damaging	1.00
R1678:Zswim9	UTSW	7	13277411	missense	probably benign	0.04
R1745:Zswim9	UTSW	7	13269556	missense	probably damaging	1.00
R1938:Zswim9	UTSW	7	13260214	nonsense	probably null
R2025:Zswim9	UTSW	7	13269366	missense	probably damaging	0.98
R3149:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3150:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3176:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3177:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3276:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R3277:Zswim9	UTSW	7	13277270	missense	possibly damaging	0.94
R4554:Zswim9	UTSW	7	13277162	missense	probably benign	0.33
R4866:Zswim9	UTSW	7	13261169	missense	probably damaging	0.99
R4953:Zswim9	UTSW	7	13269558	missense	probably damaging	1.00
R5330:Zswim9	UTSW	7	13259985	missense	probably damaging	1.00
R5394:Zswim9	UTSW	7	13260983	missense	probably damaging	1.00
R5408:Zswim9	UTSW	7	13260826	missense	possibly damaging	0.66
R5654:Zswim9	UTSW	7	13261168	missense	probably damaging	0.99
R5810:Zswim9	UTSW	7	13260735	missense	probably damaging	0.98
R5859:Zswim9	UTSW	7	13261445	missense	probably damaging	0.99
R6235:Zswim9	UTSW	7	13261603	missense	probably damaging	1.00
R6239:Zswim9	UTSW	7	13261331	nonsense	probably null
R6249:Zswim9	UTSW	7	13260977	missense	probably damaging	0.98
R6394:Zswim9	UTSW	7	13260963	missense	probably damaging	0.99
R7077:Zswim9	UTSW	7	13259752	missense	probably damaging	1.00
R7133:Zswim9	UTSW	7	13259737	missense	probably damaging	0.98
R7178:Zswim9	UTSW	7	13259997	missense	possibly damaging	0.53
R7595:Zswim9	UTSW	7	13261072	missense	probably benign	0.21
R8005:Zswim9	UTSW	7	13261138	missense	probably damaging	0.98
R8138:Zswim9	UTSW	7	13261411	missense	probably damaging	1.00
R8818:Zswim9	UTSW	7	13260529	missense	probably benign	0.19
R9241:Zswim9	UTSW	7	13269434	missense	probably damaging	1.00
R9277:Zswim9	UTSW	7	13261057	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTGACATCAGGAGCGCTTTGC -3'
(R):5'- GCAAACCCATGGACGAATGG -3'

Sequencing Primer
(F):5'- GCTTTGCAGCAGGGAAACC -3'
(R):5'- GGATTTGCATTACACGCACG -3'

Posted On

2015-04-17