Incidental Mutation 'R3950:Ticrr'
ID 307865
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 040930-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R3950 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79331817 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 776 (L776S)
Ref Sequence ENSEMBL: ENSMUSP00000145735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: L776S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: L776S

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: L776S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Meta Mutation Damage Score 0.4235 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,494,747 (GRCm39) probably null Het
Ahnak2 A T 12: 112,749,409 (GRCm39) I186N probably damaging Het
Appbp2 A G 11: 85,085,532 (GRCm39) I458T probably damaging Het
Arhgef25 T C 10: 127,021,013 (GRCm39) Y291C probably damaging Het
Ate1 T C 7: 130,069,022 (GRCm39) Y415C probably damaging Het
B4galt4 G T 16: 38,588,384 (GRCm39) A72S probably benign Het
C3 T C 17: 57,532,286 (GRCm39) R178G probably benign Het
Cdh23 T C 10: 60,493,105 (GRCm39) Y3C probably benign Het
Col11a1 T C 3: 113,915,094 (GRCm39) probably null Het
Col22a1 A G 15: 71,849,207 (GRCm39) F294L possibly damaging Het
Dera A G 6: 137,814,118 (GRCm39) Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 (GRCm39) Y276* probably null Het
Eea1 A T 10: 95,877,996 (GRCm39) N1389I probably damaging Het
Epha4 A T 1: 77,376,353 (GRCm39) Y509N probably damaging Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Fezf1 T A 6: 23,247,419 (GRCm39) K219* probably null Het
Fsd1 G A 17: 56,302,517 (GRCm39) probably null Het
Haspin A G 11: 73,027,221 (GRCm39) Y623H probably damaging Het
Hsd3b1 C T 3: 98,763,454 (GRCm39) V56M possibly damaging Het
Hyou1 C T 9: 44,296,524 (GRCm39) T483I probably damaging Het
Kdm2a A G 19: 4,393,260 (GRCm39) L365S possibly damaging Het
Kdm6b G T 11: 69,296,441 (GRCm39) P609T probably damaging Het
Klhl18 T A 9: 110,257,970 (GRCm39) Y490F probably damaging Het
Ky C T 9: 102,419,627 (GRCm39) Q545* probably null Het
L1td1 T C 4: 98,625,590 (GRCm39) L595P probably benign Het
Map3k20 T G 2: 72,268,644 (GRCm39) I550M probably damaging Het
Mug1 T A 6: 121,855,489 (GRCm39) V941E probably damaging Het
Ndst1 T C 18: 60,830,211 (GRCm39) N633S probably benign Het
Ninl A T 2: 150,794,408 (GRCm39) I740K possibly damaging Het
Npepl1 A G 2: 173,962,906 (GRCm39) N431D probably damaging Het
Or5w10 T C 2: 87,375,409 (GRCm39) T160A probably damaging Het
Pacs2 T C 12: 113,024,733 (GRCm39) S408P probably damaging Het
Pard6b C T 2: 167,941,114 (GRCm39) T367I probably damaging Het
Pcdhga7 A G 18: 37,849,568 (GRCm39) E525G probably damaging Het
Pctp A G 11: 89,878,144 (GRCm39) I130T probably benign Het
Pcx C T 19: 4,667,995 (GRCm39) H506Y probably benign Het
Pdhx A G 2: 102,865,586 (GRCm39) S199P probably damaging Het
Pdia2 C A 17: 26,416,590 (GRCm39) probably null Het
Pif1 C A 9: 65,499,116 (GRCm39) N445K probably damaging Het
Prickle4 T C 17: 47,999,507 (GRCm39) K349E probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 A T 13: 48,742,670 (GRCm39) M173K probably damaging Het
Rb1 A G 14: 73,500,102 (GRCm39) L515P probably damaging Het
Rcvrn A G 11: 67,590,877 (GRCm39) K154E probably damaging Het
Ros1 C T 10: 51,942,484 (GRCm39) V2059I probably damaging Het
Rtn4ip1 T A 10: 43,785,893 (GRCm39) probably null Het
Sema5a T C 15: 32,689,484 (GRCm39) Y1050H probably damaging Het
Slc25a28 C T 19: 43,652,708 (GRCm39) V318I probably benign Het
Srek1 G A 13: 103,881,403 (GRCm39) R408W unknown Het
Synrg C T 11: 83,880,641 (GRCm39) T444I probably damaging Het
Tmem127 T C 2: 127,090,577 (GRCm39) L31P probably damaging Het
Tmprss15 T A 16: 78,870,074 (GRCm39) T190S probably benign Het
Trip10 T A 17: 57,560,411 (GRCm39) probably null Het
Ttc6 A G 12: 57,696,292 (GRCm39) Y31C probably damaging Het
Unc80 A T 1: 66,661,729 (GRCm39) H1718L possibly damaging Het
Zbtb38 A G 9: 96,569,599 (GRCm39) F495S probably damaging Het
Zfp280d G T 9: 72,203,301 (GRCm39) Q16H possibly damaging Het
Zfp521 A G 18: 13,979,403 (GRCm39) S337P probably damaging Het
Zswim9 T A 7: 12,995,503 (GRCm39) T218S possibly damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGTGCCAGCTTCAGGTATTTC -3'
(R):5'- CGGGGATGGAGCCAATATAC -3'

Sequencing Primer
(F):5'- AGATGTGTGAGCAGTGCCC -3'
(R):5'- ATGGAGCCAATATACCTGTGG -3'
Posted On 2015-04-17