Mutagenetix > Incidental Mutation

Incidental Mutation 'R3950:Pif1'

307870

Institutional Source

Beutler Lab

Gene Symbol

Pif1

Ensembl Gene

ENSMUSG00000041064

Gene Name

PIF1 5'-to-3' DNA helicase

Synonyms

AI449441

MMRRC Submission

040930-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65587160-65595967 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 65591834 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 445 (N445K)

Ref Sequence

ENSEMBL: ENSMUSP00000122060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047099] [ENSMUST00000131483] [ENSMUST00000134538] [ENSMUST00000136205] [ENSMUST00000141046] [ENSMUST00000154970]

AlphaFold

Q80SX8

Predicted Effect

probably damaging
Transcript: ENSMUST00000047099
AA Change: N445K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049046
Gene: ENSMUSG00000041064
AA Change: N445K

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
Pfam:AAA_30	215	426	1.8e-15	PFAM
Pfam:PIF1	215	513	2.1e-79	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000131483
AA Change: N445K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117494
Gene: ENSMUSG00000041064
AA Change: N445K

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
Pfam:AAA_30	215	426	1.8e-15	PFAM
Pfam:PIF1	215	513	2.1e-79	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000134538
AA Change: N445K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122060
Gene: ENSMUSG00000041064
AA Change: N445K

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
Pfam:AAA_30	215	426	1.8e-15	PFAM
Pfam:PIF1	215	513	2.1e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136205

Predicted Effect

probably benign
Transcript: ENSMUST00000141046

SMART Domains

Protein: ENSMUSP00000120400
Gene: ENSMUSG00000041064

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152529

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152885

Predicted Effect

probably benign
Transcript: ENSMUST00000154970

SMART Domains

Protein: ENSMUSP00000117085
Gene: ENSMUSG00000041064

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
Pfam:AAA_30	215	410	1e-14	PFAM
Pfam:PIF1	215	410	8e-59	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent adenosine triphosphate (ATP)-metabolizing enzyme that functions as a 5' to 3' DNA helicase. The encoded protein can resolve G-quadruplex structures and RNA-DNA hybrids at the ends of chromosomes. It also prevents telomere elongation by inhibiting the actions of telomerase. Alternative splicing and the use of alternative start codons results in multiple isoforms that are differentially localized to either the mitochondria or the nucleus. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and show no evidence of increased sensitivity to DNA damage, genetic instability, reproducible telomere length alteration or other cellular abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Ahnak2	A	T	12: 112,785,789	I186N	probably damaging	Het
Appbp2	A	G	11: 85,194,706	I458T	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
B4galt4	G	T	16: 38,768,022	A72S	probably benign	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col11a1	T	C	3: 114,121,445		probably null	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm2a	A	G	19: 4,343,232	L365S	possibly damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Klhl18	T	A	9: 110,428,902	Y490F	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Ttc6	A	G	12: 57,649,506	Y31C	probably damaging	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zbtb38	A	G	9: 96,687,546	F495S	probably damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het
Zswim9	T	A	7: 13,261,577	T218S	possibly damaging	Het

Other mutations in Pif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pif1	APN	9	65593277	missense	probably damaging	1.00
IGL01343:Pif1	APN	9	65589562	missense	probably damaging	1.00
IGL01753:Pif1	APN	9	65593308	missense	probably damaging	1.00
R0415:Pif1	UTSW	9	65588051	missense	probably benign	0.00
R1087:Pif1	UTSW	9	65589095	missense	probably benign
R1742:Pif1	UTSW	9	65587850	missense	probably benign	0.12
R1861:Pif1	UTSW	9	65589453	missense	probably damaging	1.00
R3804:Pif1	UTSW	9	65588306	missense	probably damaging	0.99
R4457:Pif1	UTSW	9	65587776	utr 5 prime	probably benign
R4853:Pif1	UTSW	9	65593576	missense	probably damaging	1.00
R5192:Pif1	UTSW	9	65588092	missense	probably benign	0.02
R5196:Pif1	UTSW	9	65588092	missense	probably benign	0.02
R5269:Pif1	UTSW	9	65591829	missense	possibly damaging	0.82
R6703:Pif1	UTSW	9	65593263	missense	probably damaging	1.00
R7451:Pif1	UTSW	9	65588348	missense	probably benign	0.00
R7556:Pif1	UTSW	9	65589711	critical splice acceptor site	probably null
R7938:Pif1	UTSW	9	65594791	missense	probably benign	0.01
R8723:Pif1	UTSW	9	65594391	missense	probably damaging	1.00
R8952:Pif1	UTSW	9	65592217	missense	probably damaging	1.00
R8968:Pif1	UTSW	9	65591794	missense	probably damaging	1.00
X0064:Pif1	UTSW	9	65594478	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- TGCCCCTTTTGAGTCCCAAG -3'
(R):5'- ATTGACTTGTGGCTCAGCTTC -3'

Sequencing Primer
(F):5'- AAGACTTGGCCTGTGCAG -3'
(R):5'- TGGCTCAGCTTCCACAAATG -3'

Posted On

2015-04-17