Incidental Mutation 'R3950:Pif1'
ID307870
Institutional Source Beutler Lab
Gene Symbol Pif1
Ensembl Gene ENSMUSG00000041064
Gene NamePIF1 5'-to-3' DNA helicase
SynonymsAI449441
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3950 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location65587160-65595967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65591834 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 445 (N445K)
Ref Sequence ENSEMBL: ENSMUSP00000122060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047099] [ENSMUST00000131483] [ENSMUST00000134538] [ENSMUST00000136205] [ENSMUST00000141046] [ENSMUST00000154970]
Predicted Effect probably damaging
Transcript: ENSMUST00000047099
AA Change: N445K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049046
Gene: ENSMUSG00000041064
AA Change: N445K

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131483
AA Change: N445K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117494
Gene: ENSMUSG00000041064
AA Change: N445K

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134538
AA Change: N445K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122060
Gene: ENSMUSG00000041064
AA Change: N445K

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136205
Predicted Effect probably benign
Transcript: ENSMUST00000141046
SMART Domains Protein: ENSMUSP00000120400
Gene: ENSMUSG00000041064

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152885
Predicted Effect probably benign
Transcript: ENSMUST00000154970
SMART Domains Protein: ENSMUSP00000117085
Gene: ENSMUSG00000041064

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 410 1e-14 PFAM
Pfam:PIF1 215 410 8e-59 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent adenosine triphosphate (ATP)-metabolizing enzyme that functions as a 5' to 3' DNA helicase. The encoded protein can resolve G-quadruplex structures and RNA-DNA hybrids at the ends of chromosomes. It also prevents telomere elongation by inhibiting the actions of telomerase. Alternative splicing and the use of alternative start codons results in multiple isoforms that are differentially localized to either the mitochondria or the nucleus. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and show no evidence of increased sensitivity to DNA damage, genetic instability, reproducible telomere length alteration or other cellular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Pif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pif1 APN 9 65593277 missense probably damaging 1.00
IGL01343:Pif1 APN 9 65589562 missense probably damaging 1.00
IGL01753:Pif1 APN 9 65593308 missense probably damaging 1.00
R0415:Pif1 UTSW 9 65588051 missense probably benign 0.00
R1087:Pif1 UTSW 9 65589095 missense probably benign
R1742:Pif1 UTSW 9 65587850 missense probably benign 0.12
R1861:Pif1 UTSW 9 65589453 missense probably damaging 1.00
R3804:Pif1 UTSW 9 65588306 missense probably damaging 0.99
R4457:Pif1 UTSW 9 65587776 utr 5 prime probably benign
R4853:Pif1 UTSW 9 65593576 missense probably damaging 1.00
R5192:Pif1 UTSW 9 65588092 missense probably benign 0.02
R5196:Pif1 UTSW 9 65588092 missense probably benign 0.02
R5269:Pif1 UTSW 9 65591829 missense possibly damaging 0.82
R6703:Pif1 UTSW 9 65593263 missense probably damaging 1.00
R7451:Pif1 UTSW 9 65588348 missense probably benign 0.00
R7556:Pif1 UTSW 9 65589711 critical splice acceptor site probably null
R7938:Pif1 UTSW 9 65594791 missense probably benign 0.01
X0064:Pif1 UTSW 9 65594478 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGCCCCTTTTGAGTCCCAAG -3'
(R):5'- ATTGACTTGTGGCTCAGCTTC -3'

Sequencing Primer
(F):5'- AAGACTTGGCCTGTGCAG -3'
(R):5'- TGGCTCAGCTTCCACAAATG -3'
Posted On2015-04-17