Mutagenetix > Incidental Mutations

Incidental Mutation 'R3950:Zbtb38'

307872

Institutional Source

Beutler Lab

Gene Symbol

Zbtb38

Ensembl Gene

ENSMUSG00000040433

Gene Name

zinc finger and BTB domain containing 38

Synonyms

CIBZ, A930014K01Rik, Zenon homolog

MMRRC Submission

040930-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.543) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96682770-96752831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96687546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 495 (F495S)

Ref Sequence

ENSEMBL: ENSMUSP00000121753 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]

AlphaFold

Q3LR78

Predicted Effect

probably damaging
Transcript: ENSMUST00000093798
AA Change: F495S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: F495S

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	935	N/A	INTRINSIC
low complexity region	994	1002	N/A	INTRINSIC
ZnF_C2H2	1013	1035	3.63e-3	SMART
ZnF_C2H2	1041	1063	9.73e-4	SMART
ZnF_C2H2	1069	1091	1.45e-2	SMART
ZnF_C2H2	1097	1119	1.02e1	SMART
ZnF_C2H2	1128	1150	1.67e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000126066
AA Change: F495S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433
AA Change: F495S

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	926	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128269

SMART Domains

Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140121
AA Change: F495S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433
AA Change: F495S

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000152594
AA Change: F495S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: F495S

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	935	N/A	INTRINSIC
low complexity region	994	1002	N/A	INTRINSIC
ZnF_C2H2	1013	1035	3.63e-3	SMART
ZnF_C2H2	1041	1063	9.73e-4	SMART
ZnF_C2H2	1069	1091	1.45e-2	SMART
ZnF_C2H2	1097	1119	1.02e1	SMART
ZnF_C2H2	1128	1150	1.67e-2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Ahnak2	A	T	12: 112,785,789	I186N	probably damaging	Het
Appbp2	A	G	11: 85,194,706	I458T	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
B4galt4	G	T	16: 38,768,022	A72S	probably benign	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col11a1	T	C	3: 114,121,445		probably null	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm2a	A	G	19: 4,343,232	L365S	possibly damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Klhl18	T	A	9: 110,428,902	Y490F	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Pif1	C	A	9: 65,591,834	N445K	probably damaging	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Ttc6	A	G	12: 57,649,506	Y31C	probably damaging	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het
Zswim9	T	A	7: 13,261,577	T218S	possibly damaging	Het

Other mutations in Zbtb38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Zbtb38	APN	9	96687494	missense	probably damaging	1.00
IGL01895:Zbtb38	APN	9	96688408	missense	probably benign	0.00
IGL02513:Zbtb38	APN	9	96687073	missense	probably damaging	1.00
IGL02649:Zbtb38	APN	9	96686619	missense	probably damaging	0.96
IGL02938:Zbtb38	APN	9	96687174	missense	probably benign	0.11
PIT4131001:Zbtb38	UTSW	9	96686316	missense	probably damaging	1.00
R0048:Zbtb38	UTSW	9	96687676	missense	probably damaging	1.00
R0152:Zbtb38	UTSW	9	96686280	missense	probably damaging	1.00
R0158:Zbtb38	UTSW	9	96686940	missense	possibly damaging	0.46
R0519:Zbtb38	UTSW	9	96685773	missense	probably damaging	1.00
R0594:Zbtb38	UTSW	9	96685954	missense	probably damaging	1.00
R1556:Zbtb38	UTSW	9	96686991	missense	probably benign	0.26
R1698:Zbtb38	UTSW	9	96685462	missense	probably benign
R1772:Zbtb38	UTSW	9	96688041	missense	probably damaging	1.00
R1799:Zbtb38	UTSW	9	96688881	missense	probably damaging	1.00
R1837:Zbtb38	UTSW	9	96686995	missense	probably benign
R2446:Zbtb38	UTSW	9	96687646	missense	probably damaging	1.00
R3153:Zbtb38	UTSW	9	96688249	missense	probably benign	0.34
R4240:Zbtb38	UTSW	9	96686102	small deletion	probably benign
R4630:Zbtb38	UTSW	9	96688851	missense	probably damaging	1.00
R4666:Zbtb38	UTSW	9	96688383	missense	probably damaging	1.00
R4732:Zbtb38	UTSW	9	96687684	missense	probably damaging	1.00
R4733:Zbtb38	UTSW	9	96687684	missense	probably damaging	1.00
R4824:Zbtb38	UTSW	9	96688201	missense	probably benign	0.06
R5006:Zbtb38	UTSW	9	96685651	missense	probably damaging	1.00
R5109:Zbtb38	UTSW	9	96687009	missense	probably damaging	0.99
R5251:Zbtb38	UTSW	9	96687108	missense	probably benign	0.43
R5396:Zbtb38	UTSW	9	96687643	missense	probably damaging	1.00
R5659:Zbtb38	UTSW	9	96687420	missense	probably damaging	1.00
R6249:Zbtb38	UTSW	9	96685992	missense	probably damaging	0.99
R6294:Zbtb38	UTSW	9	96687229	missense	probably benign	0.05
R6615:Zbtb38	UTSW	9	96686654	nonsense	probably null
R6625:Zbtb38	UTSW	9	96687313	missense	probably damaging	1.00
R6885:Zbtb38	UTSW	9	96686464	missense	probably damaging	1.00
R7304:Zbtb38	UTSW	9	96687427	missense	probably damaging	0.96
R7675:Zbtb38	UTSW	9	96685541	missense	probably benign	0.00
R7823:Zbtb38	UTSW	9	96685976	nonsense	probably null
R7900:Zbtb38	UTSW	9	96688936	missense	probably damaging	1.00
R8077:Zbtb38	UTSW	9	96688100	missense	probably benign
R8432:Zbtb38	UTSW	9	96686238	missense	possibly damaging	0.68
R8802:Zbtb38	UTSW	9	96685570	missense	probably benign	0.13
R8930:Zbtb38	UTSW	9	96686381	missense	probably benign	0.04
R8932:Zbtb38	UTSW	9	96686381	missense	probably benign	0.04
R9008:Zbtb38	UTSW	9	96687047	missense	probably benign
R9347:Zbtb38	UTSW	9	96685596	missense	probably damaging	0.99
X0066:Zbtb38	UTSW	9	96687612	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTGTAAAGTTTGTATGGATAGACAG -3'
(R):5'- ATTGGCGAACTATCCAGCGC -3'

Sequencing Primer
(F):5'- TATGGATAGACAGTAGGCTTCAAGC -3'
(R):5'- AACTATCCAGCGCGGGGAG -3'

Posted On

2015-04-17