Mutagenetix > Incidental Mutations

Incidental Mutation 'R3950:Klhl18'

307874

Institutional Source

Beutler Lab

Gene Symbol

Klhl18

Ensembl Gene

ENSMUSG00000054792

Gene Name

kelch-like 18

Synonyms

MMRRC Submission

040930-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110425926-110476694 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110428902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 490 (Y490F)

Ref Sequence

ENSEMBL: ENSMUSP00000143634 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068025] [ENSMUST00000198164] [ENSMUST00000198400]

AlphaFold

E9Q4F2

Predicted Effect

probably damaging
Transcript: ENSMUST00000068025
AA Change: Y485F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000069674
Gene: ENSMUSG00000054792
AA Change: Y485F

Domain	Start	End	E-Value	Type
BTB	38	135	1.32e-29	SMART
BACK	140	242	1.67e-39	SMART
Kelch	289	336	1.78e-14	SMART
Kelch	337	383	2.64e-17	SMART
Kelch	384	430	2.18e-18	SMART
Kelch	431	477	9.27e-13	SMART
Kelch	478	524	3.34e-5	SMART
Kelch	525	571	1.22e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111934
AA Change: Y490F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107565
Gene: ENSMUSG00000054792
AA Change: Y490F

Domain	Start	End	E-Value	Type
BTB	38	135	1.32e-29	SMART
BACK	140	242	1.67e-39	SMART
Kelch	289	341	8.52e-12	SMART
Kelch	342	388	2.64e-17	SMART
Kelch	389	435	2.18e-18	SMART
Kelch	436	482	9.27e-13	SMART
Kelch	483	529	3.34e-5	SMART
Kelch	530	576	1.22e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197336

Predicted Effect

probably damaging
Transcript: ENSMUST00000198164
AA Change: Y490F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143634
Gene: ENSMUSG00000054792
AA Change: Y490F

Domain	Start	End	E-Value	Type
BTB	38	135	1.32e-29	SMART
BACK	140	242	1.67e-39	SMART
Kelch	289	341	8.52e-12	SMART
Kelch	342	388	2.64e-17	SMART
Kelch	389	435	2.18e-18	SMART
Kelch	436	482	9.27e-13	SMART
Kelch	483	529	3.34e-5	SMART
Kelch	530	576	1.22e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000198400
AA Change: Y420F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143384
Gene: ENSMUSG00000054792
AA Change: Y420F

Domain	Start	End	E-Value	Type
Pfam:BTB	1	70	2.1e-15	PFAM
BACK	75	177	1.67e-39	SMART
Kelch	224	271	1.78e-14	SMART
Kelch	272	318	2.64e-17	SMART
Kelch	319	365	2.18e-18	SMART
Kelch	366	412	9.27e-13	SMART
Kelch	413	459	3.34e-5	SMART
Kelch	460	506	1.22e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199700

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Ahnak2	A	T	12: 112,785,789	I186N	probably damaging	Het
Appbp2	A	G	11: 85,194,706	I458T	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
B4galt4	G	T	16: 38,768,022	A72S	probably benign	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col11a1	T	C	3: 114,121,445		probably null	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm2a	A	G	19: 4,343,232	L365S	possibly damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Pif1	C	A	9: 65,591,834	N445K	probably damaging	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Ttc6	A	G	12: 57,649,506	Y31C	probably damaging	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zbtb38	A	G	9: 96,687,546	F495S	probably damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het
Zswim9	T	A	7: 13,261,577	T218S	possibly damaging	Het

Other mutations in Klhl18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01108:Klhl18	APN	9	110428686	missense	probably damaging	1.00
IGL01338:Klhl18	APN	9	110455433	missense	probably damaging	1.00
IGL01455:Klhl18	APN	9	110432443	missense	probably damaging	1.00
IGL01954:Klhl18	APN	9	110428866	missense	probably damaging	1.00
IGL01960:Klhl18	APN	9	110450746	missense	probably benign	0.25
IGL02195:Klhl18	APN	9	110438902	missense	possibly damaging	0.92
IGL02430:Klhl18	APN	9	110437401	missense	probably benign	0.25
IGL02629:Klhl18	APN	9	110429938	splice site	probably benign
Mixie	UTSW	9	110436062	missense	probably benign	0.00
R0389:Klhl18	UTSW	9	110428681	missense	probably benign	0.00
R1538:Klhl18	UTSW	9	110446747	missense	probably damaging	1.00
R1777:Klhl18	UTSW	9	110437401	missense	probably benign	0.25
R1966:Klhl18	UTSW	9	110476590	missense	probably benign	0.14
R2099:Klhl18	UTSW	9	110455418	missense	probably damaging	1.00
R3699:Klhl18	UTSW	9	110436066	missense	probably benign	0.06
R3911:Klhl18	UTSW	9	110436083	missense	probably damaging	1.00
R4197:Klhl18	UTSW	9	110429944	critical splice donor site	probably null
R4500:Klhl18	UTSW	9	110429966	missense	probably damaging	1.00
R4936:Klhl18	UTSW	9	110428961	missense	possibly damaging	0.88
R5296:Klhl18	UTSW	9	110436127	missense	possibly damaging	0.64
R5298:Klhl18	UTSW	9	110436127	missense	possibly damaging	0.64
R5301:Klhl18	UTSW	9	110436127	missense	possibly damaging	0.64
R5407:Klhl18	UTSW	9	110436127	missense	possibly damaging	0.64
R5433:Klhl18	UTSW	9	110436127	missense	possibly damaging	0.64
R5641:Klhl18	UTSW	9	110446828	missense	probably damaging	1.00
R6084:Klhl18	UTSW	9	110428727	missense	possibly damaging	0.52
R6279:Klhl18	UTSW	9	110436062	missense	probably benign	0.00
R6300:Klhl18	UTSW	9	110436062	missense	probably benign	0.00
R6425:Klhl18	UTSW	9	110446681	missense	possibly damaging	0.85
R6465:Klhl18	UTSW	9	110428920	missense	probably benign	0.21
R6521:Klhl18	UTSW	9	110428635	missense	possibly damaging	0.92
R6587:Klhl18	UTSW	9	110455426	missense	probably damaging	1.00
R6730:Klhl18	UTSW	9	110428911	missense	probably damaging	0.98
R7110:Klhl18	UTSW	9	110450765	missense	probably damaging	0.99
R7492:Klhl18	UTSW	9	110428775	nonsense	probably null
R7580:Klhl18	UTSW	9	110436050	missense	probably benign	0.00
R7598:Klhl18	UTSW	9	110446810	nonsense	probably null
R7789:Klhl18	UTSW	9	110439008	missense	unknown
R7988:Klhl18	UTSW	9	110476509	missense	possibly damaging	0.87
R8050:Klhl18	UTSW	9	110428761	missense	probably damaging	1.00
Z1176:Klhl18	UTSW	9	110437347	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- CCACTGAGCTTAGGTTTGACTG -3'
(R):5'- GCATCAGAGCAAGGGTACAC -3'

Sequencing Primer
(F):5'- AGGTTTGACTGTCCATCGTAAC -3'
(R):5'- CACCGTGTAGGCTTCTGTGC -3'

Posted On

2015-04-17