Incidental Mutation 'R3950:Eea1'
ID307880
Institutional Source Beutler Lab
Gene Symbol Eea1
Ensembl Gene ENSMUSG00000036499
Gene Nameearly endosome antigen 1
SynonymsZFYVE2, B230358H09Rik, A430109M19Rik
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R3950 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location95940650-96045518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96042134 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1389 (N1389I)
Ref Sequence ENSEMBL: ENSMUSP00000061493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053484]
Predicted Effect probably damaging
Transcript: ENSMUST00000053484
AA Change: N1389I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061493
Gene: ENSMUSG00000036499
AA Change: N1389I

DomainStartEndE-ValueType
ZnF_C2H2 41 64 2.2e-2 SMART
low complexity region 98 123 N/A INTRINSIC
low complexity region 135 148 N/A INTRINSIC
low complexity region 389 408 N/A INTRINSIC
low complexity region 480 500 N/A INTRINSIC
low complexity region 573 585 N/A INTRINSIC
low complexity region 616 630 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 748 760 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 947 958 N/A INTRINSIC
low complexity region 996 1010 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1198 1217 N/A INTRINSIC
FYVE 1344 1411 1.99e-28 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Eea1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Eea1 APN 10 96031677 missense probably damaging 0.99
IGL01645:Eea1 APN 10 95989589 missense probably damaging 1.00
IGL01646:Eea1 APN 10 95997015 missense probably damaging 0.99
IGL01870:Eea1 APN 10 95973986 missense probably damaging 1.00
IGL02074:Eea1 APN 10 96037487 missense probably damaging 1.00
IGL02229:Eea1 APN 10 96018184 missense probably damaging 1.00
IGL02885:Eea1 APN 10 96041484 missense probably benign 0.04
IGL02971:Eea1 APN 10 96041527 missense probably benign 0.37
IGL03223:Eea1 APN 10 96039611 missense probably damaging 1.00
IGL03355:Eea1 APN 10 96042212 utr 3 prime probably benign
Senior UTSW 10 96011037 missense probably benign
Slump UTSW 10 96036633 missense probably benign 0.00
R0189:Eea1 UTSW 10 95995582 missense possibly damaging 0.86
R0374:Eea1 UTSW 10 96039772 splice site probably benign
R0655:Eea1 UTSW 10 95995598 missense probably benign 0.00
R0883:Eea1 UTSW 10 96021667 missense possibly damaging 0.63
R1219:Eea1 UTSW 10 96010761 splice site probably benign
R1344:Eea1 UTSW 10 95994999 critical splice donor site probably null
R1768:Eea1 UTSW 10 95996960 missense probably damaging 1.00
R1887:Eea1 UTSW 10 96018211 critical splice donor site probably null
R2224:Eea1 UTSW 10 96020012 missense probably damaging 0.99
R2927:Eea1 UTSW 10 96013358 missense probably benign 0.00
R3922:Eea1 UTSW 10 96036633 missense probably benign 0.00
R4502:Eea1 UTSW 10 96039565 missense probably benign 0.14
R4647:Eea1 UTSW 10 96028393 missense probably benign
R4876:Eea1 UTSW 10 95995613 missense probably benign 0.07
R5009:Eea1 UTSW 10 96011021 missense probably benign
R5018:Eea1 UTSW 10 96011037 missense probably benign
R5490:Eea1 UTSW 10 96026054 missense probably benign 0.41
R5588:Eea1 UTSW 10 96023910 missense probably benign 0.01
R5791:Eea1 UTSW 10 96019995 missense probably benign 0.24
R5799:Eea1 UTSW 10 96002948 missense possibly damaging 0.81
R5842:Eea1 UTSW 10 96018124 missense probably damaging 1.00
R6332:Eea1 UTSW 10 96041473 missense possibly damaging 0.79
R6376:Eea1 UTSW 10 96038798 missense probably benign 0.01
R6468:Eea1 UTSW 10 96028412 missense probably benign 0.14
R6740:Eea1 UTSW 10 96023993 missense probably benign
R6889:Eea1 UTSW 10 96037478 missense probably benign 0.14
R6904:Eea1 UTSW 10 96002879 splice site probably null
R7269:Eea1 UTSW 10 96018138 missense probably damaging 1.00
R7273:Eea1 UTSW 10 95989631 missense probably benign 0.00
R7398:Eea1 UTSW 10 95995631 missense probably benign
R7400:Eea1 UTSW 10 95995570 missense probably benign 0.02
R7537:Eea1 UTSW 10 95994905 nonsense probably null
R7687:Eea1 UTSW 10 96026598 missense probably benign
R7762:Eea1 UTSW 10 96028439 missense probably benign 0.10
R8097:Eea1 UTSW 10 96026654 missense probably benign 0.01
R8114:Eea1 UTSW 10 95994989 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGATAAACTCAAGCACTCAGG -3'
(R):5'- TCTGACCTTGGCATGAAAGC -3'

Sequencing Primer
(F):5'- TCAAGCACTCAGGTATCATCAG -3'
(R):5'- ACCTTGGCATGAAAGCTGTTTTAG -3'
Posted On2015-04-17