Incidental Mutation 'R3950:Haspin'
ID307885
Institutional Source Beutler Lab
Gene Symbol Haspin
Ensembl Gene ENSMUSG00000050107
Gene Namehistone H3 associated protein kinase
SynonymsGsg2
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R3950 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73135485-73138294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73136395 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 623 (Y623H)
Ref Sequence ENSEMBL: ENSMUSP00000055806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000052140] [ENSMUST00000102537]
Predicted Effect probably benign
Transcript: ENSMUST00000006101
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052140
AA Change: Y623H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055806
Gene: ENSMUSG00000050107
AA Change: Y623H

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 357 378 N/A INTRINSIC
SCOP:d1h8fa_ 437 619 1e-8 SMART
DUF3635 664 753 3.83e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102537
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Haspin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Haspin APN 11 73137405 missense possibly damaging 0.85
IGL03088:Haspin APN 11 73136625 missense probably damaging 1.00
IGL03103:Haspin APN 11 73136700 missense probably damaging 1.00
yesterday UTSW 11 73137551 nonsense probably null
R0034:Haspin UTSW 11 73138218 missense probably damaging 1.00
R0276:Haspin UTSW 11 73136487 missense probably damaging 1.00
R0313:Haspin UTSW 11 73136298 missense probably damaging 0.97
R2165:Haspin UTSW 11 73136630 missense probably damaging 1.00
R2326:Haspin UTSW 11 73136085 missense probably benign 0.05
R4168:Haspin UTSW 11 73136022 missense probably damaging 1.00
R4565:Haspin UTSW 11 73137619 missense probably benign 0.00
R6532:Haspin UTSW 11 73137551 nonsense probably null
R6552:Haspin UTSW 11 73137564 missense probably benign 0.02
R6952:Haspin UTSW 11 73136145 missense possibly damaging 0.95
R7237:Haspin UTSW 11 73136886 missense probably benign 0.02
R7512:Haspin UTSW 11 73136592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCCACAGCACATTATTG -3'
(R):5'- TGACTTGGAGCGAATGAAAACC -3'

Sequencing Primer
(F):5'- CCACAGCACATTATTGTAAGGGTG -3'
(R):5'- TGAAAACCAAGCTGTCCTCTGTG -3'
Posted On2015-04-17