Mutagenetix > Incidental Mutations

Incidental Mutation 'R3950:Appbp2'

307887

Institutional Source

Beutler Lab

Gene Symbol

Appbp2

Ensembl Gene

ENSMUSG00000018481

Gene Name

amyloid beta precursor protein (cytoplasmic tail) binding protein 2

Synonyms

PAT1, 1300003O07Rik

MMRRC Submission

040930-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.721) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85187262-85235130 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85194706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 458 (I458T)

Ref Sequence

ENSEMBL: ENSMUSP00000018625 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018625]

AlphaFold

Q9DAX9

Predicted Effect

probably damaging
Transcript: ENSMUST00000018625
AA Change: I458T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018625
Gene: ENSMUSG00000018481
AA Change: I458T

Domain	Start	End	E-Value	Type
Pfam:TPR_12	395	461	6.5e-13	PFAM
Pfam:TPR_10	428	467	1.1e-9	PFAM
Pfam:TPR_7	432	466	1.2e-5	PFAM
Pfam:TPR_10	470	509	8.9e-7	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. The encoded protein may be involved in regulating cell death. This gene has been found to be highly expressed in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Ahnak2	A	T	12: 112,785,789	I186N	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
B4galt4	G	T	16: 38,768,022	A72S	probably benign	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col11a1	T	C	3: 114,121,445		probably null	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm2a	A	G	19: 4,343,232	L365S	possibly damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Klhl18	T	A	9: 110,428,902	Y490F	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Pif1	C	A	9: 65,591,834	N445K	probably damaging	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Ttc6	A	G	12: 57,649,506	Y31C	probably damaging	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zbtb38	A	G	9: 96,687,546	F495S	probably damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het
Zswim9	T	A	7: 13,261,577	T218S	possibly damaging	Het

Other mutations in Appbp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01736:Appbp2	APN	11	85214317	missense	possibly damaging	0.86
IGL02112:Appbp2	APN	11	85201620	missense	probably benign	0.04
IGL03051:Appbp2	APN	11	85191739	missense	possibly damaging	0.90
IGL03068:Appbp2	APN	11	85201420	missense	probably damaging	1.00
IGL03260:Appbp2	APN	11	85216457	missense	probably benign	0.00
IGL03358:Appbp2	APN	11	85210034	missense	probably benign	0.17
R0017:Appbp2	UTSW	11	85214303	missense	possibly damaging	0.46
R0267:Appbp2	UTSW	11	85201462	missense	probably damaging	1.00
R0504:Appbp2	UTSW	11	85191687	missense	probably benign	0.05
R1661:Appbp2	UTSW	11	85210110	critical splice acceptor site	probably null
R3438:Appbp2	UTSW	11	85198140	missense	probably damaging	1.00
R3817:Appbp2	UTSW	11	85198108	missense	probably damaging	1.00
R4273:Appbp2	UTSW	11	85234676	missense	probably damaging	1.00
R4574:Appbp2	UTSW	11	85209938	critical splice donor site	probably null
R4948:Appbp2	UTSW	11	85194583	missense	possibly damaging	0.87
R5322:Appbp2	UTSW	11	85196064	critical splice donor site	probably null
R5581:Appbp2	UTSW	11	85210095	missense	possibly damaging	0.92
R5593:Appbp2	UTSW	11	85194583	missense	possibly damaging	0.87
R5698:Appbp2	UTSW	11	85210099	missense	probably damaging	1.00
R7095:Appbp2	UTSW	11	85234727	nonsense	probably null
R7141:Appbp2	UTSW	11	85191751	nonsense	probably null
R9410:Appbp2	UTSW	11	85215241	missense	probably damaging	1.00
X0058:Appbp2	UTSW	11	85201630	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGTCAGCAGGATCTAGGAGC -3'
(R):5'- CCAGTAATGTTTTGCAGCAGC -3'

Sequencing Primer
(F):5'- ATCTAGGAGCACAGACAAGC -3'
(R):5'- CAGCAGCTTTCGGAAAAGGC -3'

Posted On

2015-04-17