Mutagenetix > Incidental Mutation

Incidental Mutation 'R3950:Ttc6'

307889

Institutional Source

Beutler Lab

Gene Symbol

Ttc6

Ensembl Gene

ENSMUSG00000046782

Gene Name

tetratricopeptide repeat domain 6

Synonyms

EG639426, LOC217602, Gm9813

MMRRC Submission

040930-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R3950 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57564113-57737928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57649506 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 31 (Y31C)

Ref Sequence

ENSEMBL: ENSMUSP00000133313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172852] [ENSMUST00000172939]

AlphaFold

G3UYY4

Predicted Effect

probably damaging
Transcript: ENSMUST00000172852
AA Change: Y31C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000172939
AA Change: Y583C

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: Y583C

Domain	Start	End	E-Value	Type
coiled coil region	18	42	N/A	INTRINSIC
low complexity region	146	162	N/A	INTRINSIC
low complexity region	188	212	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	486	495	N/A	INTRINSIC
low complexity region	670	685	N/A	INTRINSIC
low complexity region	733	740	N/A	INTRINSIC
TPR	889	922	2e-4	SMART
TPR	957	989	2.36e1	SMART
TPR	990	1022	2.63e1	SMART
TPR	1023	1056	9.39e-1	SMART
TPR	1057	1090	3.78e-5	SMART
Blast:TPR	1126	1157	1e-11	BLAST
SEL1	1160	1192	3.39e1	SMART
TPR	1160	1194	4.44e1	SMART
TPR	1195	1228	7.87e0	SMART
Blast:TPR	1229	1262	1e-11	BLAST
TPR	1297	1330	1.24e0	SMART
SEL1	1341	1372	9.26e-1	SMART
TPR	1341	1374	3.45e-8	SMART
TPR	1375	1407	8.76e-1	SMART
TPR	1408	1441	1.45e-1	SMART
TPR	1442	1475	1.36e1	SMART
TPR	1476	1509	7.34e-3	SMART
TPR	1513	1546	1.01e0	SMART
TPR	1547	1580	2.55e-2	SMART
TPR	1581	1617	2.43e1	SMART
Blast:TPR	1618	1651	4e-12	BLAST
TPR	1652	1685	7.87e0	SMART
TPR	1686	1718	2.35e-1	SMART
SEL1	1719	1750	1.21e2	SMART
TPR	1719	1752	1.65e-5	SMART
TPR	1753	1786	1.66e-1	SMART
TPR	1787	1820	1.45e-1	SMART
TPR	1821	1854	3.27e0	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,403		probably null	Het
Ahnak2	A	T	12: 112,785,789	I186N	probably damaging	Het
Appbp2	A	G	11: 85,194,706	I458T	probably damaging	Het
Arhgef25	T	C	10: 127,185,144	Y291C	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
B4galt4	G	T	16: 38,768,022	A72S	probably benign	Het
C3	T	C	17: 57,225,286	R178G	probably benign	Het
Cdh23	T	C	10: 60,657,326	Y3C	probably benign	Het
Col11a1	T	C	3: 114,121,445		probably null	Het
Col22a1	A	G	15: 71,977,358	F294L	possibly damaging	Het
Dera	A	G	6: 137,837,120	Y100C	probably damaging	Het
Dync2h1	A	T	9: 7,112,061	Y276*	probably null	Het
Eea1	A	T	10: 96,042,134	N1389I	probably damaging	Het
Epha4	A	T	1: 77,399,716	Y509N	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	A	6: 23,247,420	K219*	probably null	Het
Fsd1	G	A	17: 55,995,517		probably null	Het
Haspin	A	G	11: 73,136,395	Y623H	probably damaging	Het
Hsd3b1	C	T	3: 98,856,138	V56M	possibly damaging	Het
Hyou1	C	T	9: 44,385,227	T483I	probably damaging	Het
Kdm2a	A	G	19: 4,343,232	L365S	possibly damaging	Het
Kdm6b	G	T	11: 69,405,615	P609T	probably damaging	Het
Klhl18	T	A	9: 110,428,902	Y490F	probably damaging	Het
Ky	C	T	9: 102,542,428	Q545*	probably null	Het
L1td1	T	C	4: 98,737,353	L595P	probably benign	Het
Map3k20	T	G	2: 72,438,300	I550M	probably damaging	Het
Mug1	T	A	6: 121,878,530	V941E	probably damaging	Het
Ndst1	T	C	18: 60,697,139	N633S	probably benign	Het
Ninl	A	T	2: 150,952,488	I740K	possibly damaging	Het
Npepl1	A	G	2: 174,121,113	N431D	probably damaging	Het
Olfr1128	T	C	2: 87,545,065	T160A	probably damaging	Het
Pacs2	T	C	12: 113,061,113	S408P	probably damaging	Het
Pard6b	C	T	2: 168,099,194	T367I	probably damaging	Het
Pcdhga7	A	G	18: 37,716,515	E525G	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pcx	C	T	19: 4,617,967	H506Y	probably benign	Het
Pdhx	A	G	2: 103,035,241	S199P	probably damaging	Het
Pdia2	C	A	17: 26,197,616		probably null	Het
Pif1	C	A	9: 65,591,834	N445K	probably damaging	Het
Prickle4	T	C	17: 47,688,582	K349E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	A	T	13: 48,589,194	M173K	probably damaging	Het
Rb1	A	G	14: 73,262,662	L515P	probably damaging	Het
Rcvrn	A	G	11: 67,700,051	K154E	probably damaging	Het
Ros1	C	T	10: 52,066,388	V2059I	probably damaging	Het
Rtn4ip1	T	A	10: 43,909,897		probably null	Het
Sema5a	T	C	15: 32,689,338	Y1050H	probably damaging	Het
Slc25a28	C	T	19: 43,664,269	V318I	probably benign	Het
Srek1	G	A	13: 103,744,895	R408W	unknown	Het
Synrg	C	T	11: 83,989,815	T444I	probably damaging	Het
Ticrr	T	C	7: 79,682,069	L776S	probably damaging	Het
Tmem127	T	C	2: 127,248,657	L31P	probably damaging	Het
Tmprss15	T	A	16: 79,073,186	T190S	probably benign	Het
Trip10	T	A	17: 57,253,411		probably null	Het
Unc80	A	T	1: 66,622,570	H1718L	possibly damaging	Het
Zbtb38	A	G	9: 96,687,546	F495S	probably damaging	Het
Zfp280d	G	T	9: 72,296,019	Q16H	possibly damaging	Het
Zfp521	A	G	18: 13,846,346	S337P	probably damaging	Het
Zswim9	T	A	7: 13,261,577	T218S	possibly damaging	Het

Other mutations in Ttc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03278:Ttc6	APN	12	57622026	missense	probably damaging	0.99
polonius	UTSW	12	57658142	splice site	probably null
tybalt	UTSW	12	57673756	missense	possibly damaging	0.85
IGL02802:Ttc6	UTSW	12	57575868	missense	probably benign	0.14
PIT4802001:Ttc6	UTSW	12	57725676	missense	possibly damaging	0.89
R0698:Ttc6	UTSW	12	57673216	missense	probably benign	0.04
R0988:Ttc6	UTSW	12	57688649	splice site	probably benign
R1290:Ttc6	UTSW	12	57660413	missense	probably benign	0.00
R1338:Ttc6	UTSW	12	57616369	missense	probably benign	0.10
R1468:Ttc6	UTSW	12	57674677	missense	possibly damaging	0.54
R1468:Ttc6	UTSW	12	57674677	missense	possibly damaging	0.54
R1481:Ttc6	UTSW	12	57737130	missense	probably damaging	1.00
R1488:Ttc6	UTSW	12	57649515	missense	possibly damaging	0.66
R1558:Ttc6	UTSW	12	57686346	missense	probably benign	0.14
R1570:Ttc6	UTSW	12	57674763	missense	probably damaging	0.98
R1619:Ttc6	UTSW	12	57737668	missense	possibly damaging	0.73
R1819:Ttc6	UTSW	12	57694500	critical splice donor site	probably null
R1826:Ttc6	UTSW	12	57660247	missense	probably benign	0.10
R1863:Ttc6	UTSW	12	57714095	missense	probably benign	0.04
R1872:Ttc6	UTSW	12	57704552	critical splice donor site	probably null
R1887:Ttc6	UTSW	12	57673258	missense	probably benign	0.04
R1937:Ttc6	UTSW	12	57616323	missense	probably benign	0.02
R2014:Ttc6	UTSW	12	57576217	missense	possibly damaging	0.92
R2056:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2058:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2059:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2152:Ttc6	UTSW	12	57705552	missense	probably damaging	0.98
R2179:Ttc6	UTSW	12	57673118	missense	possibly damaging	0.62
R2275:Ttc6	UTSW	12	57702298	missense	probably benign	0.01
R2432:Ttc6	UTSW	12	57622035	missense	possibly damaging	0.79
R2474:Ttc6	UTSW	12	57575927	missense	probably benign	0.37
R2853:Ttc6	UTSW	12	57576181	missense	probably damaging	0.96
R3848:Ttc6	UTSW	12	57677146	missense	probably damaging	0.97
R3853:Ttc6	UTSW	12	57728549	missense	possibly damaging	0.88
R3953:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3954:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3955:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3957:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R4135:Ttc6	UTSW	12	57632795	intron	probably benign
R4387:Ttc6	UTSW	12	57643050	missense	probably benign	0.00
R4577:Ttc6	UTSW	12	57576655	missense	probably benign	0.22
R4747:Ttc6	UTSW	12	57674692	missense	possibly damaging	0.86
R4779:Ttc6	UTSW	12	57729451	missense	probably damaging	1.00
R4803:Ttc6	UTSW	12	57728505	missense	probably damaging	1.00
R4871:Ttc6	UTSW	12	57702356	missense	probably damaging	0.96
R4898:Ttc6	UTSW	12	57660240	missense	probably benign	0.00
R4930:Ttc6	UTSW	12	57673823	critical splice donor site	probably null
R4946:Ttc6	UTSW	12	57643140	missense	probably benign	0.01
R5257:Ttc6	UTSW	12	57702275	missense	possibly damaging	0.92
R5303:Ttc6	UTSW	12	57575820	missense	possibly damaging	0.90
R5385:Ttc6	UTSW	12	57643035	splice site	probably null
R5402:Ttc6	UTSW	12	57737031	nonsense	probably null
R5428:Ttc6	UTSW	12	57689834	missense	probably null	0.98
R5436:Ttc6	UTSW	12	57674594	splice site	probably null
R5646:Ttc6	UTSW	12	57576019	missense	probably damaging	0.99
R5697:Ttc6	UTSW	12	57677214	missense	probably benign	0.22
R5792:Ttc6	UTSW	12	57673204	missense	possibly damaging	0.71
R5808:Ttc6	UTSW	12	57617611	missense	possibly damaging	0.84
R5842:Ttc6	UTSW	12	57737016	missense	probably damaging	1.00
R5935:Ttc6	UTSW	12	57673804	missense	probably damaging	0.98
R6144:Ttc6	UTSW	12	57673100	missense	possibly damaging	0.83
R6155:Ttc6	UTSW	12	57737616	missense	possibly damaging	0.84
R6283:Ttc6	UTSW	12	57702262	missense	possibly damaging	0.95
R6371:Ttc6	UTSW	12	57728463	missense	possibly damaging	0.89
R6715:Ttc6	UTSW	12	57674770	critical splice donor site	probably null
R6738:Ttc6	UTSW	12	57688640	missense	probably damaging	0.99
R6795:Ttc6	UTSW	12	57704413	missense	probably damaging	0.96
R6959:Ttc6	UTSW	12	57658142	splice site	probably null
R7053:Ttc6	UTSW	12	57660532	missense	probably benign	0.01
R7125:Ttc6	UTSW	12	57576339	missense	probably benign	0.00
R7259:Ttc6	UTSW	12	57576184	missense	probably benign	0.00
R7304:Ttc6	UTSW	12	57576051	missense	probably damaging	0.96
R7369:Ttc6	UTSW	12	57672931	critical splice acceptor site	probably null
R7409:Ttc6	UTSW	12	57696986	missense	probably damaging	0.99
R7429:Ttc6	UTSW	12	57658102	missense	probably benign	0.00
R7430:Ttc6	UTSW	12	57658102	missense	probably benign	0.00
R7492:Ttc6	UTSW	12	57673136	missense	probably benign	0.02
R7535:Ttc6	UTSW	12	57576519	missense	probably benign	0.00
R7866:Ttc6	UTSW	12	57674649	missense	probably damaging	0.97
R7901:Ttc6	UTSW	12	57688567	missense	probably damaging	1.00
R7944:Ttc6	UTSW	12	57660443	missense	possibly damaging	0.46
R7945:Ttc6	UTSW	12	57660443	missense	possibly damaging	0.46
R7965:Ttc6	UTSW	12	57673756	missense	possibly damaging	0.85
R8062:Ttc6	UTSW	12	57736978	missense	possibly damaging	0.90
R8119:Ttc6	UTSW	12	57705643	missense	possibly damaging	0.78
R8142:Ttc6	UTSW	12	57697472	missense	possibly damaging	0.87
R8154:Ttc6	UTSW	12	57729424	missense	probably damaging	1.00
R8171:Ttc6	UTSW	12	57673310	missense	probably damaging	1.00
R8335:Ttc6	UTSW	12	57660291	missense	probably benign	0.00
R8343:Ttc6	UTSW	12	57660496	missense	possibly damaging	0.47
R8696:Ttc6	UTSW	12	57737706	missense	probably benign	0.20
R8875:Ttc6	UTSW	12	57704413	missense	probably damaging	0.96
R8875:Ttc6	UTSW	12	57729408	missense	possibly damaging	0.46
R8876:Ttc6	UTSW	12	57737703	missense	possibly damaging	0.81
R8924:Ttc6	UTSW	12	57651004	nonsense	probably null
R8944:Ttc6	UTSW	12	57643040	missense
R8956:Ttc6	UTSW	12	57728410	nonsense	probably null
R9009:Ttc6	UTSW	12	57697433	missense	probably damaging	1.00
R9020:Ttc6	UTSW	12	57705580	missense	probably damaging	1.00
R9051:Ttc6	UTSW	12	57737163	missense	probably damaging	1.00
R9232:Ttc6	UTSW	12	57729424	missense	probably damaging	1.00
R9291:Ttc6	UTSW	12	57575944	missense	probably damaging	0.99
R9304:Ttc6	UTSW	12	57729331	missense	probably damaging	0.99
R9309:Ttc6	UTSW	12	57706863	missense	possibly damaging	0.69
R9331:Ttc6	UTSW	12	57673723	missense	probably damaging	1.00
R9398:Ttc6	UTSW	12	57737618	nonsense	probably null
R9430:Ttc6	UTSW	12	57686407	missense	probably damaging	1.00
R9632:Ttc6	UTSW	12	57617513	missense	probably benign
R9688:Ttc6	UTSW	12	57673816	missense	possibly damaging	0.92
R9732:Ttc6	UTSW	12	57728549	missense	probably benign	0.36
R9740:Ttc6	UTSW	12	57689710	missense	probably damaging	1.00
R9749:Ttc6	UTSW	12	57654773	missense	probably benign	0.00
X0021:Ttc6	UTSW	12	57576118	missense	probably damaging	0.96
X0058:Ttc6	UTSW	12	57706851	missense	probably damaging	0.99
Z1176:Ttc6	UTSW	12	57697375	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CAATGTGGCAGGAATTTGGG -3'
(R):5'- AGGCATGTTTTCTTGTCTAGCTAC -3'

Sequencing Primer
(F):5'- AATGTGGCAGGAATTTGGGGTTTTG -3'
(R):5'- TACATACACATATATGCCAGAA -3'

Posted On

2015-04-17