Incidental Mutation 'R3950:Ttc6'
ID 307889
Institutional Source Beutler Lab
Gene Symbol Ttc6
Ensembl Gene ENSMUSG00000046782
Gene Name tetratricopeptide repeat domain 6
Synonyms EG639426, LOC217602, Gm9813
MMRRC Submission 040930-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R3950 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 57564113-57737928 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57649506 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 31 (Y31C)
Ref Sequence ENSEMBL: ENSMUSP00000133313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172852] [ENSMUST00000172939]
AlphaFold G3UYY4
Predicted Effect probably damaging
Transcript: ENSMUST00000172852
AA Change: Y31C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000172939
AA Change: Y583C

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: Y583C

DomainStartEndE-ValueType
coiled coil region 18 42 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
low complexity region 188 212 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 486 495 N/A INTRINSIC
low complexity region 670 685 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
TPR 889 922 2e-4 SMART
TPR 957 989 2.36e1 SMART
TPR 990 1022 2.63e1 SMART
TPR 1023 1056 9.39e-1 SMART
TPR 1057 1090 3.78e-5 SMART
Blast:TPR 1126 1157 1e-11 BLAST
SEL1 1160 1192 3.39e1 SMART
TPR 1160 1194 4.44e1 SMART
TPR 1195 1228 7.87e0 SMART
Blast:TPR 1229 1262 1e-11 BLAST
TPR 1297 1330 1.24e0 SMART
SEL1 1341 1372 9.26e-1 SMART
TPR 1341 1374 3.45e-8 SMART
TPR 1375 1407 8.76e-1 SMART
TPR 1408 1441 1.45e-1 SMART
TPR 1442 1475 1.36e1 SMART
TPR 1476 1509 7.34e-3 SMART
TPR 1513 1546 1.01e0 SMART
TPR 1547 1580 2.55e-2 SMART
TPR 1581 1617 2.43e1 SMART
Blast:TPR 1618 1651 4e-12 BLAST
TPR 1652 1685 7.87e0 SMART
TPR 1686 1718 2.35e-1 SMART
SEL1 1719 1750 1.21e2 SMART
TPR 1719 1752 1.65e-5 SMART
TPR 1753 1786 1.66e-1 SMART
TPR 1787 1820 1.45e-1 SMART
TPR 1821 1854 3.27e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Ttc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03278:Ttc6 APN 12 57622026 missense probably damaging 0.99
polonius UTSW 12 57658142 splice site probably null
tybalt UTSW 12 57673756 missense possibly damaging 0.85
IGL02802:Ttc6 UTSW 12 57575868 missense probably benign 0.14
PIT4802001:Ttc6 UTSW 12 57725676 missense possibly damaging 0.89
R0698:Ttc6 UTSW 12 57673216 missense probably benign 0.04
R0988:Ttc6 UTSW 12 57688649 splice site probably benign
R1290:Ttc6 UTSW 12 57660413 missense probably benign 0.00
R1338:Ttc6 UTSW 12 57616369 missense probably benign 0.10
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1481:Ttc6 UTSW 12 57737130 missense probably damaging 1.00
R1488:Ttc6 UTSW 12 57649515 missense possibly damaging 0.66
R1558:Ttc6 UTSW 12 57686346 missense probably benign 0.14
R1570:Ttc6 UTSW 12 57674763 missense probably damaging 0.98
R1619:Ttc6 UTSW 12 57737668 missense possibly damaging 0.73
R1819:Ttc6 UTSW 12 57694500 critical splice donor site probably null
R1826:Ttc6 UTSW 12 57660247 missense probably benign 0.10
R1863:Ttc6 UTSW 12 57714095 missense probably benign 0.04
R1872:Ttc6 UTSW 12 57704552 critical splice donor site probably null
R1887:Ttc6 UTSW 12 57673258 missense probably benign 0.04
R1937:Ttc6 UTSW 12 57616323 missense probably benign 0.02
R2014:Ttc6 UTSW 12 57576217 missense possibly damaging 0.92
R2056:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2058:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2059:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2152:Ttc6 UTSW 12 57705552 missense probably damaging 0.98
R2179:Ttc6 UTSW 12 57673118 missense possibly damaging 0.62
R2275:Ttc6 UTSW 12 57702298 missense probably benign 0.01
R2432:Ttc6 UTSW 12 57622035 missense possibly damaging 0.79
R2474:Ttc6 UTSW 12 57575927 missense probably benign 0.37
R2853:Ttc6 UTSW 12 57576181 missense probably damaging 0.96
R3848:Ttc6 UTSW 12 57677146 missense probably damaging 0.97
R3853:Ttc6 UTSW 12 57728549 missense possibly damaging 0.88
R3953:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3954:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3955:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3957:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R4135:Ttc6 UTSW 12 57632795 intron probably benign
R4387:Ttc6 UTSW 12 57643050 missense probably benign 0.00
R4577:Ttc6 UTSW 12 57576655 missense probably benign 0.22
R4747:Ttc6 UTSW 12 57674692 missense possibly damaging 0.86
R4779:Ttc6 UTSW 12 57729451 missense probably damaging 1.00
R4803:Ttc6 UTSW 12 57728505 missense probably damaging 1.00
R4871:Ttc6 UTSW 12 57702356 missense probably damaging 0.96
R4898:Ttc6 UTSW 12 57660240 missense probably benign 0.00
R4930:Ttc6 UTSW 12 57673823 critical splice donor site probably null
R4946:Ttc6 UTSW 12 57643140 missense probably benign 0.01
R5257:Ttc6 UTSW 12 57702275 missense possibly damaging 0.92
R5303:Ttc6 UTSW 12 57575820 missense possibly damaging 0.90
R5385:Ttc6 UTSW 12 57643035 splice site probably null
R5402:Ttc6 UTSW 12 57737031 nonsense probably null
R5428:Ttc6 UTSW 12 57689834 missense probably null 0.98
R5436:Ttc6 UTSW 12 57674594 splice site probably null
R5646:Ttc6 UTSW 12 57576019 missense probably damaging 0.99
R5697:Ttc6 UTSW 12 57677214 missense probably benign 0.22
R5792:Ttc6 UTSW 12 57673204 missense possibly damaging 0.71
R5808:Ttc6 UTSW 12 57617611 missense possibly damaging 0.84
R5842:Ttc6 UTSW 12 57737016 missense probably damaging 1.00
R5935:Ttc6 UTSW 12 57673804 missense probably damaging 0.98
R6144:Ttc6 UTSW 12 57673100 missense possibly damaging 0.83
R6155:Ttc6 UTSW 12 57737616 missense possibly damaging 0.84
R6283:Ttc6 UTSW 12 57702262 missense possibly damaging 0.95
R6371:Ttc6 UTSW 12 57728463 missense possibly damaging 0.89
R6715:Ttc6 UTSW 12 57674770 critical splice donor site probably null
R6738:Ttc6 UTSW 12 57688640 missense probably damaging 0.99
R6795:Ttc6 UTSW 12 57704413 missense probably damaging 0.96
R6959:Ttc6 UTSW 12 57658142 splice site probably null
R7053:Ttc6 UTSW 12 57660532 missense probably benign 0.01
R7125:Ttc6 UTSW 12 57576339 missense probably benign 0.00
R7259:Ttc6 UTSW 12 57576184 missense probably benign 0.00
R7304:Ttc6 UTSW 12 57576051 missense probably damaging 0.96
R7369:Ttc6 UTSW 12 57672931 critical splice acceptor site probably null
R7409:Ttc6 UTSW 12 57696986 missense probably damaging 0.99
R7429:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7430:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7492:Ttc6 UTSW 12 57673136 missense probably benign 0.02
R7535:Ttc6 UTSW 12 57576519 missense probably benign 0.00
R7866:Ttc6 UTSW 12 57674649 missense probably damaging 0.97
R7901:Ttc6 UTSW 12 57688567 missense probably damaging 1.00
R7944:Ttc6 UTSW 12 57660443 missense possibly damaging 0.46
R7945:Ttc6 UTSW 12 57660443 missense possibly damaging 0.46
R7965:Ttc6 UTSW 12 57673756 missense possibly damaging 0.85
R8062:Ttc6 UTSW 12 57736978 missense possibly damaging 0.90
R8119:Ttc6 UTSW 12 57705643 missense possibly damaging 0.78
R8142:Ttc6 UTSW 12 57697472 missense possibly damaging 0.87
R8154:Ttc6 UTSW 12 57729424 missense probably damaging 1.00
R8171:Ttc6 UTSW 12 57673310 missense probably damaging 1.00
R8335:Ttc6 UTSW 12 57660291 missense probably benign 0.00
R8343:Ttc6 UTSW 12 57660496 missense possibly damaging 0.47
R8696:Ttc6 UTSW 12 57737706 missense probably benign 0.20
R8875:Ttc6 UTSW 12 57704413 missense probably damaging 0.96
R8875:Ttc6 UTSW 12 57729408 missense possibly damaging 0.46
R8876:Ttc6 UTSW 12 57737703 missense possibly damaging 0.81
R8924:Ttc6 UTSW 12 57651004 nonsense probably null
R8944:Ttc6 UTSW 12 57643040 missense
R8956:Ttc6 UTSW 12 57728410 nonsense probably null
R9009:Ttc6 UTSW 12 57697433 missense probably damaging 1.00
R9020:Ttc6 UTSW 12 57705580 missense probably damaging 1.00
R9051:Ttc6 UTSW 12 57737163 missense probably damaging 1.00
R9232:Ttc6 UTSW 12 57729424 missense probably damaging 1.00
R9291:Ttc6 UTSW 12 57575944 missense probably damaging 0.99
R9304:Ttc6 UTSW 12 57729331 missense probably damaging 0.99
R9309:Ttc6 UTSW 12 57706863 missense possibly damaging 0.69
R9331:Ttc6 UTSW 12 57673723 missense probably damaging 1.00
R9398:Ttc6 UTSW 12 57737618 nonsense probably null
R9430:Ttc6 UTSW 12 57686407 missense probably damaging 1.00
R9632:Ttc6 UTSW 12 57617513 missense probably benign
R9688:Ttc6 UTSW 12 57673816 missense possibly damaging 0.92
R9732:Ttc6 UTSW 12 57728549 missense probably benign 0.36
R9740:Ttc6 UTSW 12 57689710 missense probably damaging 1.00
R9749:Ttc6 UTSW 12 57654773 missense probably benign 0.00
X0021:Ttc6 UTSW 12 57576118 missense probably damaging 0.96
X0058:Ttc6 UTSW 12 57706851 missense probably damaging 0.99
Z1176:Ttc6 UTSW 12 57697375 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAATGTGGCAGGAATTTGGG -3'
(R):5'- AGGCATGTTTTCTTGTCTAGCTAC -3'

Sequencing Primer
(F):5'- AATGTGGCAGGAATTTGGGGTTTTG -3'
(R):5'- TACATACACATATATGCCAGAA -3'
Posted On 2015-04-17