Incidental Mutation 'R0377:Sdr16c5'
ID 30789
Institutional Source Beutler Lab
Gene Symbol Sdr16c5
Ensembl Gene ENSMUSG00000028236
Gene Name short chain dehydrogenase/reductase family 16C, member 5
Synonyms Rdhe2, Scdr9
MMRRC Submission 038583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R0377 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 3995936-4019663 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 4005546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 263 (L263F)
Ref Sequence ENSEMBL: ENSMUSP00000046298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040925]
AlphaFold Q7TQA3
Predicted Effect probably benign
Transcript: ENSMUST00000040925
AA Change: L263F

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046298
Gene: ENSMUSG00000028236
AA Change: L263F

DomainStartEndE-ValueType
Pfam:KR 41 233 1.8e-17 PFAM
Pfam:adh_short 41 238 1.7e-48 PFAM
Pfam:adh_short_C2 47 228 1.3e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain alcohol dehydrogenase/reductase superfamily of proteins and is involved in the oxidation of retinol to retinaldehyde. The encoded protein is associated with the endoplasmic reticulum and is predicted to contain three transmembrane helices, suggesting that it is an integral membrane protein. It recognizes all-trans-retinol and all-trans-retinaldehyde as substrates and exhibits a strong preference for NAD(+)/NADH as cofactors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 V107F possibly damaging Het
Acad11 T A 9: 104,081,692 probably benign Het
Ache G A 5: 137,290,928 E299K possibly damaging Het
Adam5 T C 8: 24,747,541 T618A probably benign Het
Amigo2 T A 15: 97,246,380 T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 probably null Het
Armc4 G A 18: 7,127,415 R933C probably benign Het
Btaf1 A G 19: 36,989,002 K1057E probably benign Het
Cep55 T A 19: 38,071,889 L396* probably null Het
Cic C A 7: 25,285,799 H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 C1319S probably benign Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Dntt G A 19: 41,047,627 W369* probably null Het
Esp18 T A 17: 39,409,944 W27R probably benign Het
Fam227b A T 2: 126,125,000 probably benign Het
Fbxo31 G A 8: 121,559,102 probably benign Het
Gm13547 G A 2: 29,761,791 probably null Het
Gnl2 T A 4: 125,046,382 probably benign Het
Gpx2 G A 12: 76,795,156 Q74* probably null Het
Gucy2c A G 6: 136,750,917 probably null Het
Hoxa5 A T 6: 52,202,646 W250R probably damaging Het
Izumo4 G A 10: 80,702,840 R42H probably damaging Het
Kcnj12 G A 11: 61,069,396 M71I probably benign Het
Kmt2b A T 7: 30,574,193 L2333Q probably damaging Het
Mak T C 13: 41,049,348 E177G probably damaging Het
Map3k7 T A 4: 31,985,731 I218N probably damaging Het
Mark3 T C 12: 111,629,029 L393P probably damaging Het
Msh4 A G 3: 153,896,890 S234P probably benign Het
Mug1 A G 6: 121,857,361 D367G probably benign Het
Mypn A G 10: 63,127,622 probably benign Het
Ncapg T C 5: 45,693,817 V784A probably benign Het
Nutf2 T A 8: 105,878,872 V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 D180E probably damaging Het
Opn3 T C 1: 175,663,694 M258V probably damaging Het
Osbpl7 A G 11: 97,055,934 D211G probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plekhd1 G A 12: 80,706,436 probably benign Het
Pnpla6 A G 8: 3,541,501 E1165G probably damaging Het
Prkab2 T A 3: 97,662,317 D66E probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 S885R possibly damaging Het
Rab26 A T 17: 24,530,045 probably benign Het
Rab5a G A 17: 53,500,462 M175I probably benign Het
Rassf9 T A 10: 102,545,649 D297E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 Y133C probably damaging Het
Sec14l1 T G 11: 117,149,140 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca1 T C 4: 34,044,267 probably null Het
Stk36 C T 1: 74,612,730 P394L probably benign Het
Stk4 T C 2: 164,096,800 I196T probably damaging Het
Sult1b1 A T 5: 87,517,376 M233K probably damaging Het
Tmem8b C T 4: 43,674,005 T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 T104P probably benign Het
Trmt2a G A 16: 18,249,703 R80Q possibly damaging Het
Trps1 C A 15: 50,831,778 E324* probably null Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Wdr18 G A 10: 79,967,502 R400H probably benign Het
Wdr78 A G 4: 103,048,259 V775A probably damaging Het
Zfp119b T A 17: 55,938,671 H505L probably damaging Het
Zfp619 T A 7: 39,536,797 C750* probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Sdr16c5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Sdr16c5 APN 4 4012320 splice site probably benign
IGL02230:Sdr16c5 APN 4 4016354 missense probably damaging 0.99
IGL03090:Sdr16c5 APN 4 4006575 splice site probably benign
PIT4802001:Sdr16c5 UTSW 4 4012423 missense probably damaging 1.00
R0610:Sdr16c5 UTSW 4 4016116 missense possibly damaging 0.81
R2012:Sdr16c5 UTSW 4 3996244 missense probably benign
R3735:Sdr16c5 UTSW 4 4005614 missense probably benign
R3839:Sdr16c5 UTSW 4 4006601 missense probably damaging 0.96
R3896:Sdr16c5 UTSW 4 4006609 missense probably damaging 1.00
R4824:Sdr16c5 UTSW 4 4016216 nonsense probably null
R5024:Sdr16c5 UTSW 4 4010365 missense probably damaging 1.00
R5194:Sdr16c5 UTSW 4 4006663 missense probably benign 0.16
R5395:Sdr16c5 UTSW 4 4016277 missense probably benign 0.12
R6267:Sdr16c5 UTSW 4 4016162 missense probably damaging 1.00
R6352:Sdr16c5 UTSW 4 4016421 missense probably benign 0.00
R7076:Sdr16c5 UTSW 4 4006591 missense probably damaging 0.99
R9147:Sdr16c5 UTSW 4 3996200 missense probably benign
R9336:Sdr16c5 UTSW 4 4016108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAAAGAGGGTCTCTGACCTTG -3'
(R):5'- TTCCAGTTCACACTCCAGACATGC -3'

Sequencing Primer
(F):5'- TTGAAACTGTGCAATAAAGGGTC -3'
(R):5'- TTTAGAAATTGAGAGGGATGAGGGTC -3'
Posted On 2013-04-24